ID: 1107260521

View in Genome Browser
Species Human (GRCh38)
Location 13:38484994-38485016
Sequence TCCCCCTTACCCCAAACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107260521_1107260526 1 Left 1107260521 13:38484994-38485016 CCGGGGGTTTGGGGTAAGGGGGA No data
Right 1107260526 13:38485018-38485040 ATGGGGCGTTGCTGTTAAATGGG No data
1107260521_1107260525 0 Left 1107260521 13:38484994-38485016 CCGGGGGTTTGGGGTAAGGGGGA No data
Right 1107260525 13:38485017-38485039 AATGGGGCGTTGCTGTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107260521 Original CRISPR TCCCCCTTACCCCAAACCCC CGG (reversed) Intergenic
No off target data available for this crispr