ID: 1107275349

View in Genome Browser
Species Human (GRCh38)
Location 13:38671969-38671991
Sequence CTTTCTTTATGGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107275349_1107275358 27 Left 1107275349 13:38671969-38671991 CCATCCACCCTCCATAAAGAAAG No data
Right 1107275358 13:38672019-38672041 CCAGTCACCTTATTACCTAAGGG No data
1107275349_1107275354 3 Left 1107275349 13:38671969-38671991 CCATCCACCCTCCATAAAGAAAG No data
Right 1107275354 13:38671995-38672017 TACTTCTCATTCCTTTAAGAAGG No data
1107275349_1107275356 26 Left 1107275349 13:38671969-38671991 CCATCCACCCTCCATAAAGAAAG No data
Right 1107275356 13:38672018-38672040 ACCAGTCACCTTATTACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107275349 Original CRISPR CTTTCTTTATGGAGGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr