ID: 1107280504

View in Genome Browser
Species Human (GRCh38)
Location 13:38728282-38728304
Sequence CTGAGCAGGATTAAAACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107280501_1107280504 26 Left 1107280501 13:38728233-38728255 CCAGGTCACATGTTGTCGTTGAC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1107280504 13:38728282-38728304 CTGAGCAGGATTAAAACTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107280504 Original CRISPR CTGAGCAGGATTAAAACTCT AGG Intronic
901016060 1:6231495-6231517 CTGGGCAGGTCTCAAACTCTTGG - Intronic
906948030 1:50312260-50312282 CTGACCAGAATTCAGACTCTTGG - Intergenic
909062640 1:70896948-70896970 TTGAGTAGGAGTAAAACTCTAGG + Intronic
910285869 1:85553420-85553442 CTGTTCAAGATTAAAACTTTTGG + Intronic
910325719 1:86004421-86004443 TTGGGCAGGATTAAAACTAATGG - Intronic
910393953 1:86773281-86773303 TAGAGCAGGATGAAAAATCTGGG - Intergenic
912184501 1:107258682-107258704 CAGAGCAGGATTTGAACTCAGGG + Intronic
912564974 1:110580894-110580916 CTGAGCAGCATGAACACACTTGG + Intergenic
912606228 1:110992266-110992288 CTAAGCAAAATGAAAACTCTGGG - Intergenic
913285759 1:117225011-117225033 CTGAGCAGGATGCAAGATCTTGG + Intergenic
915630733 1:157152299-157152321 ATGAGCATGATTAATAATCTGGG + Intergenic
915892783 1:159786875-159786897 TTGAGCAGGATTCAAACTTTGGG + Intergenic
916274073 1:162974933-162974955 GAGAACAGGATTGAAACTCTGGG + Intergenic
916530858 1:165654938-165654960 CTCAGCATGATTAAAGCTGTAGG + Intronic
920809167 1:209265828-209265850 CTGAGCAGGGTAGAAACACTGGG - Intergenic
921016087 1:211192161-211192183 CTGAGCATGATTAAGACTTCCGG - Intergenic
921349682 1:214222857-214222879 TGGAGCAAGATTAAAACTCACGG - Intergenic
922033219 1:221824541-221824563 CTGGGCAGGGTAAAAACTCAAGG + Intergenic
1068776735 10:60875306-60875328 CTGTGCAGGATGATAACTCCTGG + Intronic
1071894681 10:90052783-90052805 CTGAGCAGGATCAGAACACTGGG - Intergenic
1074103271 10:110370341-110370363 CTGCGCAAGATTCAAATTCTAGG - Intergenic
1075550448 10:123388916-123388938 CTGAGATGAATTAAAACTTTAGG + Intergenic
1077587596 11:3465796-3465818 CTGACCAGGATTAAACCTAATGG + Intergenic
1083101783 11:60315022-60315044 CTGAGAAGGATTAAAACAAGCGG - Intergenic
1084829399 11:71757125-71757147 CTGACCAGGATTAAACCTAACGG - Intergenic
1087603324 11:100343502-100343524 CTGAGGAGAATCCAAACTCTGGG - Intronic
1088763448 11:112953665-112953687 CTGAGCTGAATTCAAACTCCAGG - Intergenic
1088928032 11:114321879-114321901 CTGGGCTGGTTTCAAACTCTTGG - Intergenic
1089131110 11:116212947-116212969 CTGATCATGGTTAAAACTGTGGG - Intergenic
1089638021 11:119828950-119828972 CTGAGCAGGACTCAACTTCTGGG + Intergenic
1092405536 12:8219606-8219628 CTGAGCAGGATTCCACATCTAGG - Intergenic
1092413842 12:8274564-8274586 CTGACCAGGATTAAACCTAATGG + Intergenic
1093764506 12:22947404-22947426 GTGGGCAGGATAAAAATTCTGGG + Intergenic
1093853939 12:24075686-24075708 CTGAGGAGCATTTAAACTTTGGG - Intergenic
1094026321 12:25963143-25963165 CTGAGCATCCTTAGAACTCTAGG - Intronic
1094129931 12:27063844-27063866 CTGGGCTGGACTCAAACTCTAGG + Intronic
1098071001 12:66674776-66674798 CTGAGCAAGATTAAAAGGCTGGG - Intronic
1103425114 12:120827061-120827083 CTTAGCAGGAGTCAAATTCTTGG + Intronic
1106619803 13:31362293-31362315 CTGGGCAACAATAAAACTCTGGG + Intergenic
1107280504 13:38728282-38728304 CTGAGCAGGATTAAAACTCTAGG + Intronic
1107363289 13:39642676-39642698 AGAAACAGGATTAAAACTCTTGG + Intergenic
1110843021 13:80164071-80164093 CTTACAAGGATTAAAACTTTGGG - Intergenic
1111598349 13:90439568-90439590 CTAAGCTGGATTCAAACTCCTGG + Intergenic
1112036069 13:95497730-95497752 CTGAACAGGTTTTAAACACTTGG - Intronic
1116201577 14:41804159-41804181 TTGAGTAGTAATAAAACTCTGGG - Intronic
1116890038 14:50259184-50259206 CTAAGCTGGATTAAAACTCCTGG + Intronic
1118747117 14:68782324-68782346 CTGAGCAGGATCACAAATCCAGG + Intergenic
1120974901 14:90239921-90239943 CTGAGTGGGATTAAAAGGCTGGG - Intergenic
1121338364 14:93090667-93090689 CTGATGAGGAATAAAACTCCAGG + Intronic
1122231832 14:100310004-100310026 CTGAGCAGGTTGCAAACTCCTGG + Intergenic
1123916349 15:25032453-25032475 CTTAGCTGGATTCAAACTCCAGG + Intergenic
1125393715 15:39224818-39224840 CTGAGCAGGATTAAAATGAGTGG + Intergenic
1127144059 15:56007050-56007072 CTGGGCAGAATTAGAAATCTCGG - Intergenic
1130696826 15:86139656-86139678 CTGAGAAGGATGAGACCTCTAGG - Intergenic
1132140701 15:99391208-99391230 CTGAGCAGGAGTATAACCCTTGG - Intergenic
1132488208 16:208475-208497 CTGAGGAAAATTAAAACACTTGG + Intronic
1133881394 16:9785907-9785929 CTGAGCAGCTTTTAAACTCCAGG - Intronic
1136105670 16:28028552-28028574 CTGCCCAGGATTTAAACTGTTGG - Intronic
1139463105 16:67138478-67138500 CTGAGAAGGATTGTAATTCTTGG - Intronic
1140497187 16:75399586-75399608 CTGGGCTGGATTCAAACTCCTGG + Intronic
1143219303 17:5248172-5248194 CTGTGCAGTATATAAACTCTAGG - Intergenic
1143979441 17:10855463-10855485 CTGAGCAGGATTTAGGCTCCTGG + Intergenic
1144343637 17:14331463-14331485 CTGAGCAGTATTGAAATTCTAGG + Intronic
1146730681 17:35191599-35191621 CTGATCAGGTTTAACACACTTGG - Intergenic
1147984888 17:44300185-44300207 CTGAGCAGGCTGAAAGTTCTGGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149051138 17:52306727-52306749 TTGAACAGGAATAAAGCTCTTGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151710158 17:75799907-75799929 CTGAGCAGGTCTCAAACTCCTGG - Intronic
1153393440 18:4590513-4590535 CTGGGCAGGAATAAAAATATTGG + Intergenic
1153856695 18:9155620-9155642 CTGACCAAGATTAAAACTGTTGG - Intronic
1154361883 18:13669776-13669798 CAGAGGATGACTAAAACTCTGGG + Intronic
1159473530 18:68887733-68887755 CTTAGCAAGGTTAAAACTTTAGG - Intronic
1159479688 18:68972710-68972732 CTGAACTGGATTAAAATTTTAGG + Intronic
1161649477 19:5475504-5475526 TAGATCAAGATTAAAACTCTAGG - Intergenic
1162767359 19:12928152-12928174 CTGAGCTGGATTTGAACTCCTGG + Intronic
1163111900 19:15166400-15166422 TTGAGTTGGATTAGAACTCTGGG - Intronic
1163884361 19:19952749-19952771 CTGGCCTGGAGTAAAACTCTGGG - Intergenic
1163898584 19:20080918-20080940 CTGGCCTGGAATAAAACTCTGGG + Intronic
1163904875 19:20143624-20143646 CTGGCCTGGAATAAAACTCTGGG - Intergenic
1163913330 19:20215826-20215848 CTGGCCTGGAATAAAACTCTGGG - Intergenic
1163948365 19:20561578-20561600 CTGGCCTGGAATAAAACTCTAGG - Intronic
1164000262 19:21092053-21092075 CTGTCCTGGAATAAAACTCTTGG + Intronic
1164043550 19:21513658-21513680 CTGTCCTGGAATAAAACTCTTGG + Intronic
1164080241 19:21856067-21856089 CTGGCCTGGAATAAAACTCTGGG + Intergenic
1164136132 19:22417993-22418015 CTGGCCTGGAATAAAACTCTGGG - Intronic
1164183160 19:22837524-22837546 CTGGCCTGGAATAAAACTCTGGG + Intergenic
1165906529 19:39197789-39197811 CTGGGCTGGTTTCAAACTCTTGG + Intronic
1166164110 19:40974813-40974835 CAGAGCAGGATTCAAATTCAGGG - Intergenic
1166186736 19:41144547-41144569 CAGAGCAGGATTCAAATTCAGGG + Intergenic
1166400636 19:42476978-42477000 CTGAGAAGGAGGGAAACTCTAGG + Intergenic
1168626234 19:57920430-57920452 CTGAGCATAATTTAATCTCTTGG - Intergenic
925974737 2:9134008-9134030 CTAACAAGGATTAATACTCTGGG - Intergenic
927792027 2:26017870-26017892 CAGAGCAGGATTCTAACACTAGG - Intergenic
928400709 2:30976860-30976882 CTGTGCAGGCTGAAAGCTCTGGG - Intronic
929127493 2:38535061-38535083 TTGAGCAGGACTGAATCTCTAGG - Intergenic
930112781 2:47693279-47693301 CTAAGCTGGACTAAAACTCCTGG + Intergenic
930874424 2:56198042-56198064 AGGAGCAGTCTTAAAACTCTGGG - Intronic
933202988 2:79471968-79471990 CTGAGAAGGATTAAGACTTTGGG - Intronic
933300351 2:80533638-80533660 ATTAGCAGGATGAAAACTCCAGG - Intronic
936975287 2:118214369-118214391 CTAAGCAGAATTTTAACTCTAGG - Intergenic
941551522 2:166921807-166921829 ATGAGCAGGAGTACAGCTCTAGG - Intronic
944679418 2:202063404-202063426 CTTAGCAGGATAAAGGCTCTTGG - Intergenic
944883917 2:204043513-204043535 GTGAGCAGGATTTCAACTCCTGG - Intergenic
1172807817 20:37625445-37625467 CTGAGGGGGAATAAAACACTAGG + Intergenic
1174904568 20:54536933-54536955 CTGAGCAGAATTAGAAGTCCAGG - Intronic
1175632338 20:60552139-60552161 CTGGACAGGATTAGAACTCAAGG - Intergenic
1177087164 21:16720433-16720455 CTGAGCAGAATTAAGACTGATGG + Intergenic
1178514506 21:33235379-33235401 CTCAGCAGGACAATAACTCTAGG + Intronic
1181426131 22:22840954-22840976 CTGACAAGGATTAAATCTGTTGG + Intronic
949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG + Intergenic
951300801 3:20994339-20994361 CTGAGAAGGCTCAAAACACTGGG + Intergenic
951937910 3:28042432-28042454 CTGAGCAGGCTTTCAACACTGGG + Intergenic
955115040 3:55989630-55989652 CTAATCAGGATTCAAACTCAGGG - Intronic
955551991 3:60094959-60094981 CTGATCATGATCAAGACTCTAGG - Intronic
957987886 3:87594784-87594806 TTGAGCAGGAGTTTAACTCTTGG - Intergenic
961723898 3:128913294-128913316 CTGAGAAGGATAAAAACTAAGGG - Intronic
961891391 3:130133185-130133207 CTGACCAGGATTAAACCTAACGG + Intergenic
962740413 3:138359214-138359236 CTGAGTGGGCTTAAAACCCTGGG + Intronic
964235531 3:154522241-154522263 CTGAGCAGGATTTAAATTGTTGG - Intergenic
965890565 3:173508701-173508723 ATGAGCAGGACAAAAACTCAAGG - Intronic
966259013 3:177953095-177953117 CTAAGCAAGTTTAGAACTCTTGG + Intergenic
969002782 4:3995628-3995650 CTGACCAGGATTAAACCTAACGG + Intergenic
969751240 4:9112903-9112925 CTGACCAGGATTAAACCTAATGG - Intergenic
969760575 4:9178365-9178387 CTGAGCAGGATTCCACATCTAGG + Intergenic
970037350 4:11752955-11752977 CTGAGCACCATTTAAACTCCTGG + Intergenic
970340590 4:15102799-15102821 CTGACCAGCATTAAGAGTCTAGG + Intergenic
971919888 4:32924417-32924439 CTGAATAGAATTTAAACTCTGGG - Intergenic
974016330 4:56652596-56652618 CTGAGCTGGTTTTGAACTCTTGG - Intronic
975774948 4:77776271-77776293 CTGGGCAGAATTAGAAATCTCGG - Exonic
982540851 4:156668627-156668649 ATGTGCAGGATTAAAACACATGG - Intergenic
984335864 4:178389338-178389360 CTGTGAAGGAGGAAAACTCTGGG + Intergenic
984784009 4:183552018-183552040 CTGAGCAGGCATAGGACTCTGGG + Intergenic
985428463 4:189854917-189854939 CTGAGCATTATTTAAACTCCTGG + Intergenic
985886348 5:2682799-2682821 CTCAGCTGGATTAAAACTTTGGG + Intergenic
988530523 5:32023267-32023289 CAGACCAGGATGAAAGCTCTGGG - Intronic
990488806 5:56284217-56284239 CTGGGCAGGTTTAACACTCTGGG + Intergenic
995844937 5:116483400-116483422 CAAAGCCTGATTAAAACTCTTGG - Intronic
995918666 5:117282899-117282921 CTAGGCAGGACTCAAACTCTTGG - Intergenic
996076894 5:119206258-119206280 CTGAGAAGAACTAAAAGTCTTGG + Intronic
996624458 5:125553158-125553180 TTGAGCAGGATAAAAGATCTGGG - Intergenic
997406610 5:133654018-133654040 CTGGGCAGGAAGAAAACTCTAGG + Intergenic
999523082 5:152372793-152372815 CTTACCAGGATGAAAATTCTAGG - Intergenic
1000088000 5:157905318-157905340 CTGAGCTGGTTTCAAACTCCTGG - Intergenic
1001318745 5:170663233-170663255 CTGAGCCAGAGTGAAACTCTGGG + Intronic
1002808300 6:600387-600409 CTGATTAGGGTTAAAACTTTTGG + Intronic
1004673187 6:17816525-17816547 CTGGGCTGGATTCAAACTCCTGG + Intronic
1006190607 6:32205599-32205621 CTGATCAGTAGTAAACCTCTGGG - Intronic
1006411855 6:33878412-33878434 ATGAACAGGACTAAAATTCTTGG - Intergenic
1008357366 6:50570494-50570516 CTTGGCTGGATTAAAACTCCCGG - Intergenic
1008572914 6:52832298-52832320 CTAAGCAGAAGTAAAACTATGGG + Intronic
1009662008 6:66625796-66625818 CTGAGCATGTTTAAATCTCATGG + Intergenic
1012587626 6:100943560-100943582 ATGAACATGTTTAAAACTCTAGG + Intergenic
1013074611 6:106760126-106760148 CTAGGCTGGATTCAAACTCTTGG + Intergenic
1016354482 6:143203176-143203198 CTGAACAAGATTTAATCTCTTGG + Intronic
1016403111 6:143701640-143701662 GTAAGCAGGATTTAAACTCAGGG - Intronic
1018729767 6:166639852-166639874 CTGTGCTGTATTAAAACTTTGGG + Intronic
1021917280 7:25446455-25446477 CTGAGAATGAGTAAACCTCTAGG + Intergenic
1022562139 7:31360660-31360682 GTGAGCAGGATTAAAAACCAAGG - Intergenic
1022659975 7:32357834-32357856 CTGAGCAGGATCTAAACCCCAGG - Intergenic
1024861956 7:53854221-53854243 CTGATCAGGATCAAACCTATTGG - Intergenic
1025144041 7:56489671-56489693 CTGACCAGGATGGAAACTCAGGG - Intergenic
1028422801 7:90652100-90652122 CAGAGCAGTAGTAAAAGTCTTGG - Intronic
1036270687 8:7300219-7300241 CTGAGCAGGATTCCACATCTAGG + Intergenic
1036350662 8:8010125-8010147 CTGAGCAGGATTCCACATCTAGG - Intergenic
1036374447 8:8188314-8188336 CTGACCAGGATTAAACCTAAGGG - Intergenic
1036876456 8:12477321-12477343 CTGACCAGGATTAAACCTAAGGG + Intergenic
1037359221 8:18055100-18055122 CTGAGCACGATTCAGACTCAGGG + Intergenic
1038123344 8:24642803-24642825 ATGGGCAGGATTTAATCTCTAGG + Intergenic
1038486223 8:27937043-27937065 CTGAGTTTCATTAAAACTCTTGG - Intronic
1039099200 8:33922753-33922775 CTGAGCATGGGTAACACTCTAGG + Intergenic
1043338968 8:79213908-79213930 TTCTGCAGCATTAAAACTCTTGG + Intergenic
1044955756 8:97477846-97477868 CTCAGCAGGATATAAAATCTTGG - Intergenic
1045723797 8:105146480-105146502 CTGAGTAAGTTTAAACCTCTTGG - Intronic
1046973277 8:120246145-120246167 CTGAGCAGAATCAGGACTCTGGG - Intronic
1047322566 8:123801772-123801794 GTCAGCATGATTAAATCTCTGGG + Intronic
1048179984 8:132185564-132185586 CAGAGCAGGATTAGAATTCTTGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1049093644 8:140535146-140535168 CTGAGCAGGATTGAGGCGCTGGG - Intronic
1052269041 9:26607289-26607311 ATGAGCAGGACTTAAATTCTGGG + Intergenic
1053446829 9:38159168-38159190 GTGAACAGGATTAACACCCTTGG + Intergenic
1056626448 9:88257449-88257471 CTGTGCAGGATTACAACGCAAGG + Intergenic
1061044436 9:128157181-128157203 CTGGGCAGGATCATAGCTCTGGG + Intergenic
1061558570 9:131387724-131387746 CTGGGCAGGTTTCACACTCTCGG - Intergenic
1192856806 X:75020716-75020738 CCAAGCTGGATTAAAACTCATGG + Intergenic
1192882488 X:75300923-75300945 CTGAGTAGGATGATAACACTGGG - Exonic
1193907668 X:87262287-87262309 CTAAGCAAGAATAAAACTTTAGG + Intergenic
1195789487 X:108567433-108567455 CAGAGGAAGATTAAAACACTAGG - Intronic
1198670160 X:139071493-139071515 ATAAGAAGGAATAAAACTCTTGG - Intronic
1199242429 X:145563280-145563302 TTGTGCGGGATTTAAACTCTGGG + Intergenic
1199246551 X:145611830-145611852 CTGAGGAGGATTATAACCTTTGG + Intergenic
1199332015 X:146573379-146573401 CCGTGCAGGATTAAAATACTGGG - Intergenic