ID: 1107281573

View in Genome Browser
Species Human (GRCh38)
Location 13:38742356-38742378
Sequence CCTCATATAGAGAAATTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107281569_1107281573 27 Left 1107281569 13:38742306-38742328 CCCTAATTTATATGGTCCAAGGA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG 0: 1
1: 0
2: 1
3: 18
4: 211
1107281570_1107281573 26 Left 1107281570 13:38742307-38742329 CCTAATTTATATGGTCCAAGGAT 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG 0: 1
1: 0
2: 1
3: 18
4: 211
1107281571_1107281573 11 Left 1107281571 13:38742322-38742344 CCAAGGATTATGAAAGTGAGAAT 0: 1
1: 0
2: 1
3: 15
4: 230
Right 1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG 0: 1
1: 0
2: 1
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107281573 Original CRISPR CCTCATATAGAGAAATTATA TGG Intronic
901113856 1:6823579-6823601 CATCATATAGAAAGATTTTATGG - Intronic
902913771 1:19622870-19622892 ACTGATATAGAGAAGTTAAAAGG + Intronic
903386608 1:22930947-22930969 CTTCATGTAGAGAAATTCTGAGG - Intergenic
905920505 1:41715853-41715875 CCTGACATAGAGAAATGCTAAGG - Intronic
913444741 1:118938873-118938895 CCTAATATACAGAATCTATAGGG - Intronic
915866167 1:159501328-159501350 CCTCACATTGAGAATTTCTAGGG - Intergenic
916339690 1:163717953-163717975 CCTCATATCCAGAATCTATAGGG + Intergenic
923336325 1:232973598-232973620 ACTCAGATAGTGGAATTATAGGG + Intronic
1068170315 10:53384328-53384350 ACTAATGCAGAGAAATTATAGGG - Intergenic
1068336497 10:55639057-55639079 TCTCATATAGAGTAATCAGAGGG + Intergenic
1068377803 10:56207571-56207593 TCTAATATAGAGAATCTATAAGG - Intergenic
1068743729 10:60504360-60504382 CCAAATTTAGAGAAATTAAAGGG + Intronic
1070894290 10:79969036-79969058 CCTTATATCCAGAATTTATAAGG - Intronic
1071685797 10:87755019-87755041 CTACACATAGAGAAATCATAAGG + Intronic
1071710865 10:88047875-88047897 CCTCCTCTATAGACATTATAAGG + Intergenic
1073935690 10:108628831-108628853 CCACATATAGTGAGATTATGTGG - Intergenic
1079793040 11:24763429-24763451 ACTAATGTAGAGAAATTGTAAGG + Intronic
1080312276 11:30908264-30908286 TTTCATTTAGAGAAATTATGGGG + Intronic
1080940361 11:36910855-36910877 CCTCATAGAGGTAAACTATATGG - Intergenic
1085993946 11:81888067-81888089 TATCATATATAGAAATTCTATGG + Intergenic
1089732583 11:120528409-120528431 CTTAATATAAAAAAATTATAGGG - Intronic
1095571654 12:43689788-43689810 CCTAATATCCAGAATTTATAAGG + Intergenic
1095692615 12:45107503-45107525 CCTAATATCCAGAATTTATAGGG - Intergenic
1096026847 12:48373383-48373405 CCTTATACACAAAAATTATAAGG + Intergenic
1097480452 12:60117545-60117567 TCTCATATCCAGAATTTATAAGG + Intergenic
1099596620 12:84674312-84674334 CTTCAGAGAGAGAAATTTTATGG - Intergenic
1099896927 12:88659997-88660019 CTACCTATAGAGAAATTACAAGG - Intergenic
1100696177 12:97096504-97096526 ACTTATATAGAAAAATTAAAAGG - Intergenic
1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG + Intronic
1107621506 13:42236076-42236098 CCTCACATAGAGAAATCCAAAGG - Intronic
1110524014 13:76514729-76514751 CATGATATAGAGAAAGTAAATGG + Intergenic
1110588008 13:77217773-77217795 GCTAATATAGACAAATTATAAGG + Intronic
1110642266 13:77839137-77839159 ACTTATATTGAGAAATTTTAGGG - Intergenic
1110672722 13:78200522-78200544 CATTATATAGTGAAATAATAGGG - Intergenic
1110997695 13:82134474-82134496 CCTAATATCCAGAATTTATAGGG + Intergenic
1111065920 13:83091045-83091067 CCTATTATACAGAATTTATATGG - Intergenic
1113151708 13:107271228-107271250 CTTAATATAGAGACATTATCTGG + Intronic
1113321659 13:109238385-109238407 CCTCAAACAGAGACAATATATGG + Intergenic
1114071956 14:19118497-19118519 TCTAATACAGAGGAATTATATGG - Intergenic
1114090301 14:19281467-19281489 TCTAATACAGAGGAATTATATGG + Intergenic
1114360019 14:21961396-21961418 CCCAATATAGAGATGTTATATGG + Intergenic
1115271471 14:31558243-31558265 CCCCATTTGGACAAATTATATGG - Intronic
1116473498 14:45312457-45312479 CCACATGTAGTGTAATTATAGGG - Intergenic
1117866213 14:60152232-60152254 CTGGATATAAAGAAATTATAAGG - Intronic
1118260040 14:64238006-64238028 CTTAATATGGATAAATTATATGG + Intronic
1118796497 14:69150538-69150560 CTTCAAATAGATAAATTATGTGG + Intronic
1119268740 14:73282229-73282251 CATCAAATAGAGAAATTAATGGG + Intronic
1120085182 14:80263896-80263918 GCTCATATAGAGCAGTTATGAGG - Intronic
1120557378 14:85945397-85945419 GCTCAGATAGAGAAATTGCATGG - Intergenic
1122911419 14:104829997-104830019 CGTCATTTAAAGAAATTAAAAGG - Intergenic
1123013149 14:105358858-105358880 ACTCATAGAGAGAAACTAAAGGG - Intronic
1124077480 15:26460146-26460168 CCTCATTTACAGAGATTTTATGG - Intergenic
1124184710 15:27514277-27514299 CCTAATTCACAGAAATTATAAGG - Intronic
1129024493 15:72557427-72557449 CCTCATATCCAGAATCTATAAGG - Intronic
1132039197 15:98511024-98511046 CCTTAAATAGAGGAATTATATGG + Intronic
1133142990 16:3761881-3761903 CCTCATTCAGAGAAATCAAAAGG - Intronic
1137095277 16:36247053-36247075 CATCATAGAAAGAAATCATAAGG - Intergenic
1144555886 17:16282549-16282571 CCTCAGAAAGAGTAATTCTAGGG - Intronic
1145192328 17:20853575-20853597 TCTCATATAGAGTAATCAGAGGG + Intronic
1146326499 17:31890683-31890705 CAATATTTAGAGAAATTATAGGG + Intronic
1149090945 17:52778468-52778490 TCTGATATAGAGAAATTATAAGG - Intergenic
1149635527 17:58165884-58165906 CCTCATAATTAGAAAATATATGG + Intergenic
1153307538 18:3645981-3646003 TCTCATATAGAGTATTTGTAAGG - Intronic
1159061938 18:63524004-63524026 CCTTAAATAGGGAAATTAAATGG + Intergenic
1159117471 18:64132160-64132182 CCAAATATAGGTAAATTATAAGG - Intergenic
1161163893 19:2775281-2775303 CCTCATGTAGAGGCATTTTAGGG - Intronic
926039434 2:9660945-9660967 TCTCAGATGGAGAAATTAGAAGG - Intergenic
926832852 2:16982449-16982471 CCACATAAAGAAATATTATATGG - Intergenic
926930846 2:18039366-18039388 CATAGTATAGAGAAATTCTAAGG + Intronic
928154064 2:28859617-28859639 CCTCATATTGAGTAATCATCTGG + Intronic
929152827 2:38762716-38762738 CTTCCCATAGAGAAATTTTACGG + Intronic
929845877 2:45526584-45526606 CTTCAAATAGGTAAATTATATGG + Intronic
930402762 2:50911412-50911434 ACTCAGGTATAGAAATTATATGG - Intronic
931600539 2:63998795-63998817 CCTTAATTAGAGAAATTAAAAGG - Intronic
932937329 2:76120226-76120248 CCTCATTTAGAAAAATAAAATGG + Intergenic
933359012 2:81253688-81253710 CCTAATATACAGAATCTATAAGG - Intergenic
933413460 2:81954000-81954022 TCTAATATAGAGAATTTACAAGG + Intergenic
938309886 2:130282749-130282771 CATCATATAGAGATATGAGATGG - Intergenic
938445031 2:131369620-131369642 CATCATATAGAGATATGAGATGG + Intergenic
938486204 2:131711919-131711941 TCTAATACAGAGGAATTATATGG - Intergenic
938817787 2:134921680-134921702 CGCCATAAAGACAAATTATAAGG - Intronic
939097114 2:137845631-137845653 ATTCATATACAGAAATAATAGGG + Intergenic
940547473 2:155106808-155106830 CCTCACATATAGAATCTATAAGG + Intergenic
943505745 2:188755191-188755213 CCTAATATACAGAATTTATAAGG - Intronic
943541598 2:189222022-189222044 CCTCAAAAAAAAAAATTATAGGG + Intergenic
944025703 2:195164373-195164395 AGTTATATAGAAAAATTATATGG - Intergenic
944583516 2:201153538-201153560 CTTCATCTAGAGTAATTATGTGG + Intronic
945111445 2:206364216-206364238 CCTCATTTAAAGAAATTAAGAGG - Intergenic
945614501 2:212051125-212051147 CCTCCTATTCAGAAATTAAAAGG + Intronic
945645873 2:212492751-212492773 ACTCAAATTGAGAAATTAAATGG - Intronic
946315993 2:218912896-218912918 CCTCATAATGTGAAATTATTTGG + Intergenic
947455196 2:230247852-230247874 ACTAATCTAGTGAAATTATATGG + Intronic
947578005 2:231292300-231292322 CCACATAAAGAGAACTTACAAGG - Intronic
1169687125 20:8288025-8288047 CCTCAGATAGAGAAGTTCTTTGG - Intronic
1170314104 20:15024902-15024924 CCTCATAAATAGAATTTGTAGGG + Intronic
1173088650 20:39949588-39949610 CTTCAAATAGAGAAGTAATATGG - Intergenic
1173234425 20:41231556-41231578 CCACATACAAAAAAATTATAAGG - Intronic
1173984649 20:47251663-47251685 CTTAACAAAGAGAAATTATAGGG + Intronic
1177338811 21:19770368-19770390 TCTCATGTAGAGAACTTTTAAGG + Intergenic
1177953048 21:27562600-27562622 CTTAATATGGAGAAATTATCCGG - Intergenic
1178194924 21:30333725-30333747 CCTCATAGAAAGAAATTATGTGG - Intergenic
1178967271 21:37132611-37132633 ACTCATATAAAGAAAAAATAGGG - Intronic
1180490398 22:15840852-15840874 TCTAATACAGAGGAATTATATGG - Intergenic
1180662082 22:17476522-17476544 CTTCTTATATAGAAATAATACGG - Intronic
1181841096 22:25662234-25662256 CCTAATATAGAGATATTACATGG - Intronic
951054831 3:18135593-18135615 CCTCATATAGAGTGGTTGTAAGG + Intronic
952013969 3:28934773-28934795 CCTGGTATAGAGGAATTTTATGG + Intergenic
956969225 3:74502989-74503011 CCTCATATAGAGTTATTATGAGG - Intronic
959372507 3:105545735-105545757 CTTCATATAAAGAAATTGAAGGG + Intronic
959452568 3:106522008-106522030 GCTCATATAGAGAAATTAGGTGG - Intergenic
962036283 3:131655070-131655092 GCAGATATAGAGAAATTTTAAGG + Intronic
964788212 3:160423105-160423127 AGTCATATATACAAATTATAGGG - Intronic
965099236 3:164275206-164275228 CCCCATATAGATTAAATATAAGG + Intergenic
965581833 3:170276894-170276916 TCTCATATCCAGAATTTATAAGG + Intronic
967958940 3:194902768-194902790 CTTCAGTTAGAAAAATTATAAGG - Intergenic
970353009 4:15224702-15224724 CCTAATATACAGAATCTATAAGG + Intergenic
970649642 4:18162098-18162120 CCTCATATATTGCAATGATAAGG + Intergenic
970971471 4:21989307-21989329 CCTCATATTGGGAACTTAAAAGG - Intergenic
971615400 4:28783456-28783478 TCTAAAATAGAGTAATTATAGGG - Intergenic
972101818 4:35430174-35430196 TATTATATAGAGAAATGATATGG + Intergenic
972102050 4:35432160-35432182 TATTATATAGAGAAATGATATGG - Intergenic
973284148 4:48396531-48396553 CCTCATATCGAGACATTAAAGGG + Intronic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
974719753 4:65723310-65723332 CCTTGTTTTGAGAAATTATATGG + Intergenic
974771578 4:66421606-66421628 CATCACCTAGATAAATTATAAGG + Intergenic
975049014 4:69836376-69836398 CATCTTATAGAGACATTCTAAGG + Intronic
978534491 4:109746706-109746728 CCTCATATTGAGCAGTTACATGG - Intronic
979302473 4:119102590-119102612 ACTACTATACAGAAATTATATGG + Intergenic
981065287 4:140477331-140477353 CTTCATAGAGACAAATGATAAGG - Intronic
982482586 4:155930286-155930308 TGTCAAATATAGAAATTATAGGG + Intronic
982669981 4:158308775-158308797 CCTAATATCCAGAAACTATAGGG - Intergenic
983451347 4:167914840-167914862 CTTCATATAGAAAAATGAAATGG - Intergenic
988593035 5:32565647-32565669 CCTTATCAAGAGAAGTTATATGG - Intronic
989402205 5:41020453-41020475 CCACATTTGGAGAAATTATGTGG + Intronic
990238463 5:53793174-53793196 CTTCAAGTAGATAAATTATATGG + Intergenic
990530144 5:56665468-56665490 TCTGATATACAGAATTTATAAGG - Intergenic
992568037 5:78022118-78022140 CCACATATGGAAAAAATATAAGG - Intronic
993223499 5:85134967-85134989 GATCATTTAGAGAAAATATATGG - Intergenic
994793898 5:104268516-104268538 CATCATATATTGAAATTAAATGG + Intergenic
995433716 5:112111731-112111753 TATCATCTAGAGAAATTTTATGG - Intergenic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999018642 5:148138183-148138205 CTCCATAGGGAGAAATTATATGG + Intergenic
999891751 5:155985512-155985534 CCTCATATTGAGATGTTCTAGGG + Intronic
1000213314 5:159130419-159130441 CCTTCTACATAGAAATTATAAGG - Intergenic
1003183733 6:3813112-3813134 CCCCATAGTGAGAAATTAGAGGG - Intergenic
1004353316 6:14910223-14910245 TCTCATTTAGGGAAATTAAAGGG + Intergenic
1008301043 6:49839837-49839859 ACTCATATAGAGTTATTATATGG + Intronic
1008737860 6:54569179-54569201 CTTCATATAGATAATTTATCTGG + Intergenic
1009781587 6:68278551-68278573 CCTAATATCCAGAAACTATAAGG - Intergenic
1010024256 6:71197404-71197426 CCTGATATGTTGAAATTATATGG - Intergenic
1010164462 6:72899055-72899077 TCTAATATACAGAATTTATAAGG - Intronic
1011158395 6:84359479-84359501 CCTCATATAGACAAATGGTTGGG + Intergenic
1011642255 6:89426647-89426669 CCTCATATCTAGAAAGTATAAGG + Intergenic
1011728972 6:90240926-90240948 CCTCATATTGACAAGTGATAGGG - Intronic
1011966036 6:93158220-93158242 CCTAATATCCAGAATTTATAAGG - Intergenic
1012057901 6:94438513-94438535 CCTCATTGAGTGAAATTATTTGG - Intergenic
1012361396 6:98385462-98385484 CTGCATTTAGAGAAATGATAAGG - Intergenic
1013573866 6:111459534-111459556 CCTAATATCCAGAATTTATAAGG + Intronic
1014179509 6:118369703-118369725 TCTAATATACAGAATTTATAAGG + Intergenic
1014337696 6:120158337-120158359 CTTCATATAGATAATGTATATGG + Intergenic
1015492715 6:133845257-133845279 ACTCATAATGAGAAATTATTAGG + Intergenic
1015855068 6:137615543-137615565 CCTCATGTAAAGAAATAATAAGG - Intergenic
1016236357 6:141871917-141871939 TCTCATATATGGCAATTATATGG - Intergenic
1016571179 6:145514826-145514848 CCTAATATAAAGAAATTTGAAGG + Intronic
1018322831 6:162631570-162631592 CCTAATATCCAGAATTTATAGGG - Intronic
1020139085 7:5603009-5603031 CCCCAGTTAGAGAAATAATAGGG - Intronic
1020414834 7:7934075-7934097 CCTCATGTAGAGGAGTTATGAGG - Intronic
1020676259 7:11188460-11188482 ACTAATATACAGAATTTATAAGG - Intergenic
1021677298 7:23094180-23094202 CATCATATACAAAAATTAAATGG - Intergenic
1023353294 7:39341605-39341627 CCTGGAATAGAGAAATTAGATGG - Intronic
1023683942 7:42716333-42716355 CCTCAGATGGAGAAATGATGTGG + Intergenic
1023963374 7:44946764-44946786 GTTCATATAGAAAAATTAGAAGG - Intergenic
1024807389 7:53159831-53159853 TCTCGTATATAGAAATTTTAAGG - Intergenic
1025226899 7:57173428-57173450 CATCATATAGAGATATTAGATGG - Intergenic
1025229966 7:57196709-57196731 CATCATATAGAGATATTAGATGG - Intergenic
1026805953 7:73429722-73429744 CCAGATACAGAGAAATAATATGG + Intergenic
1027561235 7:79732935-79732957 CCTTATTTAAAGAAATAATAGGG + Intergenic
1027600006 7:80228264-80228286 ACACATATAGAGAAAATGTAAGG - Intergenic
1027833322 7:83208685-83208707 CCTCATACATAAAAATAATAAGG - Intergenic
1028030224 7:85903262-85903284 CCCCACATAGACAAATTATTCGG + Intergenic
1028980654 7:96964542-96964564 CCTGAAATAGAGAAAATAAAGGG - Intergenic
1029925111 7:104307594-104307616 CCTCTTATAGAGTGGTTATAAGG + Intergenic
1029959742 7:104677399-104677421 CCCTATATAGTGAAACTATATGG + Intronic
1030424417 7:109356047-109356069 CCTCAGATAGAGAAGATATCGGG - Intergenic
1030811510 7:113978274-113978296 CCTTATATAGGGATATTTTAGGG + Intronic
1030850194 7:114474432-114474454 ACACATACAGAGAATTTATATGG - Intronic
1032384675 7:131513458-131513480 CCAAATATAGAGAAATGGTATGG - Intronic
1032777572 7:135129492-135129514 ACTCCCATAGAGAAATTAGATGG + Intronic
1036914292 8:12789984-12790006 CCTCAGATAGAAAAATTATCTGG + Intergenic
1038512694 8:28154503-28154525 CATCATATAGATTAAATATATGG - Intronic
1038905916 8:31903022-31903044 CCCCATGTAGAGAAATCACATGG + Intronic
1040436713 8:47398412-47398434 ACTCAGAGAGAGAAATTTTATGG + Intronic
1041102781 8:54413312-54413334 CCTCAGAGAGAGAAACTACATGG - Intergenic
1042095402 8:65210322-65210344 CCTAATATATAGAAAATTTAAGG + Intergenic
1043163835 8:76878573-76878595 ACTTATATATAGAAAATATATGG + Intergenic
1043258605 8:78168189-78168211 CCTCATAAAGTGAAAACATACGG - Intergenic
1043667019 8:82827001-82827023 GCTCATATAGAGAGATAAGAAGG - Intergenic
1048984211 8:139724494-139724516 CCTAATGAAAAGAAATTATAAGG - Intergenic
1050171090 9:2817624-2817646 CCACATATAGTGAAAGGATAAGG + Intronic
1050360783 9:4829111-4829133 ACTCATTTAGAGAGATTACAAGG + Intronic
1051387802 9:16528777-16528799 CCACATAATGGGAAATTATATGG + Intronic
1052105914 9:24515756-24515778 CTTGATATATAAAAATTATATGG + Intergenic
1052719531 9:32156362-32156384 CCTAATATAAAGAATCTATAGGG - Intergenic
1055027742 9:71740347-71740369 CCTCATATAGAAAAAACATTAGG - Intronic
1055257076 9:74384366-74384388 CCTCTTATAGAGAAATCATGAGG - Intergenic
1055538048 9:77269229-77269251 CACCATATAGAAAAATTAAATGG - Intronic
1057480745 9:95443762-95443784 CTTCATATAAATAAATTATATGG + Exonic
1058564148 9:106262566-106262588 CCTGAAATAGAGAAAATATATGG - Intergenic
1060081454 9:120650656-120650678 CCTCATATATTGAAAGTCTATGG - Intronic
1203405140 Un_KI270528v1:801-823 CATCATAGAAAGAAATCATAAGG - Intergenic
1185671304 X:1812341-1812363 CCCCATGTAGACAAATTATGAGG - Intergenic
1186013963 X:5169581-5169603 CATCATATAGAGATATTAGATGG - Intergenic
1187027745 X:15453789-15453811 TCTCATTTATAGAAATCATAAGG - Intronic
1187800654 X:23059128-23059150 ACTCATATAGCATAATTATACGG + Intergenic
1190730181 X:53220752-53220774 CCTCAGCCAGAGAAACTATAAGG + Intronic
1190886360 X:54533937-54533959 TATCATATAGAAAGATTATATGG + Intronic
1192730493 X:73798473-73798495 CATTATATAGAAAAATTAGAGGG + Intergenic
1192860771 X:75068092-75068114 AGTCATTTAGAGAAATTATTGGG - Intronic
1193310144 X:79997943-79997965 CCTGATATTAAGAAATGATAAGG + Intergenic
1193641528 X:84014767-84014789 CCTCATTTAGAGCAATTTTCTGG - Intergenic
1194274231 X:91859341-91859363 TCTCATATACAGAATCTATAAGG - Intronic
1194392293 X:93334496-93334518 CATCATCTAAAGAAATTATTTGG + Intergenic
1194791561 X:98157423-98157445 CCTAATATACAGAAACTCTAAGG + Intergenic
1196216291 X:113055830-113055852 CTTGCTATAGAGAAAGTATAGGG - Intergenic
1196401922 X:115325691-115325713 CTTCATATAGAGAAAAAAAATGG - Intergenic
1198511529 X:137356652-137356674 AATCTTATAGAGAAATTAGAAGG - Intergenic
1199435878 X:147812072-147812094 CATCATATTGAGAACTTAGAAGG - Intergenic
1199472262 X:148208389-148208411 CTTTATATAGAGAAACTCTATGG + Intergenic
1199811856 X:151357563-151357585 AGTCATATAGAAAAATTAAATGG - Intergenic
1200591467 Y:5080748-5080770 TCTCATATACAGAATCTATAAGG - Intronic
1202190453 Y:22238044-22238066 ACTGATATAGAGAAATGACATGG + Intergenic