ID: 1107282424

View in Genome Browser
Species Human (GRCh38)
Location 13:38751804-38751826
Sequence TTTTTTTTTCTAACAAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2372
Summary {0: 1, 1: 1, 2: 11, 3: 188, 4: 2171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107282422_1107282424 18 Left 1107282422 13:38751763-38751785 CCAAAATATCAATTAAATAAAAC 0: 1
1: 0
2: 9
3: 97
4: 1033
Right 1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG 0: 1
1: 1
2: 11
3: 188
4: 2171
1107282421_1107282424 25 Left 1107282421 13:38751756-38751778 CCTCGTTCCAAAATATCAATTAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG 0: 1
1: 1
2: 11
3: 188
4: 2171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107282424 Original CRISPR TTTTTTTTTCTAACAAGGAC TGG Intronic
Too many off-targets to display for this crispr