ID: 1107282817

View in Genome Browser
Species Human (GRCh38)
Location 13:38755945-38755967
Sequence ATGTAGACACAGCTGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 243}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107282817_1107282822 7 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282822 13:38755975-38755997 TTGTCATGGCCAGGGACAGATGG 0: 1
1: 1
2: 0
3: 22
4: 248
1107282817_1107282821 -1 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282821 13:38755967-38755989 TACTAATATTGTCATGGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 107
1107282817_1107282820 -2 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282820 13:38755966-38755988 ATACTAATATTGTCATGGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 152
1107282817_1107282823 11 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282823 13:38755979-38756001 CATGGCCAGGGACAGATGGCTGG 0: 1
1: 0
2: 1
3: 27
4: 328
1107282817_1107282824 14 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282824 13:38755982-38756004 GGCCAGGGACAGATGGCTGGAGG 0: 1
1: 0
2: 2
3: 41
4: 476
1107282817_1107282827 18 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282827 13:38755986-38756008 AGGGACAGATGGCTGGAGGGAGG 0: 1
1: 1
2: 11
3: 190
4: 1688
1107282817_1107282825 15 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282825 13:38755983-38756005 GCCAGGGACAGATGGCTGGAGGG 0: 1
1: 0
2: 2
3: 53
4: 465
1107282817_1107282819 -7 Left 1107282817 13:38755945-38755967 CCAAGCCACAGCTGTGTCTACAT 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1107282819 13:38755961-38755983 TCTACATACTAATATTGTCATGG 0: 1
1: 0
2: 1
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107282817 Original CRISPR ATGTAGACACAGCTGTGGCT TGG (reversed) Intronic
901032169 1:6313580-6313602 ATGTGGCCACATCTGTGGGTGGG - Intronic
902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG + Exonic
903441984 1:23395000-23395022 AGGAAGACAAAGCTGTTGCTGGG + Intronic
904320376 1:29694292-29694314 ATGTGAACTCAGCTGTGCCTGGG - Intergenic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
905811951 1:40919503-40919525 GCGTAGCCACACCTGTGGCTTGG - Intergenic
906266776 1:44437230-44437252 GCATAGACACAGCTGTGGGTGGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
907964464 1:59315726-59315748 ATCTAGACATACCTGTGGCTTGG - Intronic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
917682855 1:177385221-177385243 AATTAGAAACAGCTGTGGTTGGG - Intergenic
919213164 1:194514838-194514860 ATGTAGACACAGCTCTTGCCTGG - Intergenic
921177452 1:212607370-212607392 TTGTAGACACAAGTGTGGCCTGG - Intronic
921221041 1:212974137-212974159 ATGGGGACAAAGCTGTGTCTTGG + Intronic
922322945 1:224503725-224503747 TTGAAAACACAGCTGTGGCAAGG + Intronic
922331670 1:224582334-224582356 GTGCAGAGACAGATGTGGCTGGG + Intronic
923820727 1:237437345-237437367 AAATAGACCCAGATGTGGCTGGG - Intronic
924159841 1:241219452-241219474 ATAAAGACACACCTGAGGCTGGG - Intronic
1063168491 10:3485031-3485053 AAGTAGACACAGCTCTTCCTTGG - Intergenic
1063658384 10:8014369-8014391 ATAAAGACAAAGCCGTGGCTCGG + Intronic
1063896414 10:10686777-10686799 ATGAAGACACATCTGAGACTGGG - Intergenic
1068229850 10:54157369-54157391 ATGTGGAAACTGCTGAGGCTTGG + Intronic
1068252234 10:54457006-54457028 ATGAAGAAACACCTGTGACTGGG - Intronic
1069437835 10:68401571-68401593 ATGAATACACTTCTGTGGCTAGG + Intronic
1070816117 10:79324622-79324644 AGGAAGACACAGGTGTGACTGGG - Intergenic
1071060807 10:81569796-81569818 AAGGAGACACAGCCTTGGCTTGG + Intergenic
1072369176 10:94746037-94746059 ATGAAGAAACATCTGAGGCTGGG - Intronic
1073833701 10:107416325-107416347 ATGTAGAAATACCTGAGGCTGGG + Intergenic
1074764940 10:116693572-116693594 ATTTAGACACAGAAGTGCCTTGG - Intronic
1075024078 10:118970960-118970982 GGGTAGGCACAGCTGTGGCCAGG - Intergenic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1076076018 10:127534451-127534473 CTGTGGACAGAGCTGTGGATGGG - Intergenic
1076522829 10:131091522-131091544 AAGAAGGCATAGCTGTGGCTTGG - Intergenic
1076716775 10:132369958-132369980 ATGGAGAGACAGGTGTGGCTGGG - Intronic
1078087971 11:8245783-8245805 ATAAAGACATAGCTGAGGCTGGG + Intronic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1078918499 11:15804059-15804081 ATGTTGACACTGGTGTGTCTTGG + Intergenic
1080958416 11:37129516-37129538 ATGAAGACATAGCTGAGACTGGG - Intergenic
1081393702 11:42560112-42560134 ATGAAGACATATCTGAGGCTGGG - Intergenic
1082990840 11:59206017-59206039 ATGAAGACAGAACTGTGCCTGGG + Exonic
1083266874 11:61550908-61550930 AGGCAGACACACCTGTGTCTGGG - Intronic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1087272106 11:96122207-96122229 ATGTAGATACAGCTATGCTTTGG + Intronic
1092984798 12:13835425-13835447 AGGAAGAGACAACTGTGGCTTGG - Intronic
1094397729 12:30025831-30025853 ATGTAGAAATAGCTGAGACTAGG + Intergenic
1097323310 12:58248603-58248625 ATGAAGACACACCTGAGACTGGG + Intergenic
1097326739 12:58285720-58285742 ATGTAGAGACATCTGTGGCGGGG + Intergenic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1100579219 12:95922723-95922745 AAGTAGAAACAGCTGAGGGTGGG + Intronic
1101380170 12:104207527-104207549 ATCAAGAAATAGCTGTGGCTGGG - Intergenic
1101661183 12:106766753-106766775 ATGAAGAAAGAGCTGTTGCTAGG + Intronic
1102237251 12:111301476-111301498 ATGTAGACACATCTCTGGAGGGG + Intronic
1102758925 12:115368078-115368100 ATGAAGACATACCTGAGGCTGGG - Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107566219 13:41607618-41607640 ATGTAGACACAGCTGTCTGTGGG + Intronic
1107966165 13:45600087-45600109 CTGCAGACATAGCTGTGGTTGGG - Intronic
1111513564 13:89297816-89297838 ATGTAGGCTCAGGTGTGTCTTGG + Intergenic
1111791221 13:92858107-92858129 ATGTAGACACTGATATGGTTTGG + Intronic
1112588404 13:100740546-100740568 ATCCAGACACATCTGTGGCAGGG - Intergenic
1113764041 13:112869802-112869824 CTCTAGGAACAGCTGTGGCTTGG - Intronic
1114596598 14:23917527-23917549 ATGAAGACACTTCTGTCGCTTGG - Intergenic
1115841230 14:37472981-37473003 ATTTAGACACTGCTGTAGCTTGG + Intronic
1116151195 14:41144815-41144837 ATGTTGTCACAGCCCTGGCTTGG + Intergenic
1116188123 14:41625496-41625518 ATGAAGAAATAGCTGAGGCTTGG - Intronic
1117013417 14:51493619-51493641 ATAAAGACACAGCTGAGACTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1125646516 15:41277346-41277368 ATCTAAACATATCTGTGGCTGGG + Intronic
1126232352 15:46341887-46341909 ATTTGTACACAGCTGTTGCTTGG + Intergenic
1126750309 15:51870232-51870254 TTAAAAACACAGCTGTGGCTGGG - Intronic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128554685 15:68623451-68623473 GTGTAAACACAGCTGTGGGTGGG - Intronic
1130894594 15:88160281-88160303 AAGGAGTCACAGCTGTGCCTAGG + Intronic
1132022787 15:98377479-98377501 AAGTAGACTCAGCTATGGCAGGG + Intergenic
1133790873 16:9008418-9008440 AGGGAGACAAAGCTGCGGCTGGG - Intergenic
1134147870 16:11781879-11781901 ATGATGAGACAGCTGTGGTTTGG - Intronic
1138204988 16:55118131-55118153 AGGAACACACAGGTGTGGCTGGG - Intergenic
1140451275 16:75072769-75072791 ATGTAAACAGAGCTGTGACATGG + Intronic
1141125910 16:81401096-81401118 ACTTAAAGACAGCTGTGGCTTGG - Intergenic
1142524584 17:530963-530985 AGGCAGACACAGCTGAGGTTGGG + Intronic
1142972164 17:3620198-3620220 AGGTAGAGGCAGCTGTGTCTAGG - Intronic
1150967037 17:69982949-69982971 ATGTAGAGAAAACTTTGGCTTGG + Intergenic
1151205710 17:72505116-72505138 ATGGACACACAGCTGTGGGACGG + Intergenic
1151517141 17:74603952-74603974 AAGCAGAAACAGCTGTGCCTGGG + Intergenic
1152292134 17:79445949-79445971 CAGTTGTCACAGCTGTGGCTGGG + Intronic
1153718732 18:7879874-7879896 ATGAAGAAACACCTGAGGCTCGG + Intronic
1155830786 18:30513217-30513239 AGGGAGTCACAGCCGTGGCTTGG + Intergenic
1156515999 18:37681008-37681030 AAGTAGACCCTGATGTGGCTTGG - Intergenic
1157555555 18:48610782-48610804 ATGGAAACAGAGCTGGGGCTTGG - Intronic
1159859220 18:73627534-73627556 ATTTAGAGAAAGCTGTGACTTGG + Intergenic
1159942992 18:74422833-74422855 ATGTACACACATCTGCAGCTTGG - Intergenic
1160070597 18:75624685-75624707 ATGAGGCCACAGCTGTGACTGGG + Intergenic
1164279376 19:23756029-23756051 ATAAAGACACATATGTGGCTGGG + Intronic
1164504881 19:28851663-28851685 ATGTTTTCACACCTGTGGCTAGG + Intergenic
1165052580 19:33151397-33151419 ATGTGGACACGTCTGTAGCTTGG + Intronic
1165071615 19:33258939-33258961 ATGTATATACAGCCATGGCTGGG - Intergenic
1166408237 19:42539120-42539142 TTCTAGACACATCTGAGGCTTGG - Intronic
1166587873 19:43967200-43967222 ATGTGGAAAGAGCTTTGGCTGGG + Exonic
1166588000 19:43968469-43968491 ATGTAGAAAGAGCTTTGGCTGGG + Intronic
1166811089 19:45515120-45515142 AGGCAGACTCAGCTGTGGGTAGG - Intronic
925048276 2:790714-790736 AGGTAGTCACAGCCTTGGCTTGG - Intergenic
925443663 2:3909380-3909402 ATATAGACATACCTGTGACTGGG + Intergenic
927444609 2:23148014-23148036 GTGAAGACACAGGTCTGGCTAGG - Intergenic
928060718 2:28110326-28110348 TTATAAACACAGGTGTGGCTGGG + Intronic
928494509 2:31818600-31818622 ATAAAGACACATCTGAGGCTGGG + Intergenic
929591552 2:43150796-43150818 TTCAAGACACAGTTGTGGCTGGG + Intergenic
931870209 2:66448303-66448325 TTTAAAACACAGCTGTGGCTGGG + Intronic
931937975 2:67219174-67219196 CTGTAGAGACAGCCATGGCTGGG + Intergenic
932637061 2:73399322-73399344 ATGAAGAAACACCTGAGGCTGGG + Intronic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
933638015 2:84728255-84728277 ATGAAGACATAGCTGAGACTGGG - Intronic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
934652212 2:96099157-96099179 AGGTAGACTCACGTGTGGCTGGG - Intergenic
935172697 2:100622855-100622877 ATGAAGAAACACCTGAGGCTGGG - Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG + Intergenic
937763074 2:125628600-125628622 ATGAAGACACAACTGAGACTGGG - Intergenic
940035901 2:149311688-149311710 ATGGACACAGAGCTGTGGCATGG + Intergenic
941262348 2:163313693-163313715 ATGTACTACCAGCTGTGGCTTGG - Intergenic
943202647 2:184848712-184848734 ATGATGACACAGCTGTAGCTAGG + Intronic
943446391 2:187992947-187992969 ATGTGGACAGAGCTCTGGCTGGG + Intergenic
946760930 2:222992488-222992510 ATGTAGAGACAGCTGTAGTGTGG - Intergenic
947396471 2:229692079-229692101 GTGTAGGCACAGCAGTGTCTGGG - Intronic
948799704 2:240426753-240426775 ATGAAGAAACACCTGAGGCTGGG + Intergenic
948983288 2:241505869-241505891 ATGTAGCAGCAGCTGTGGCCTGG + Intronic
1169340004 20:4789545-4789567 ATGGGGTCACAGCTGTGCCTTGG - Intronic
1169802588 20:9525867-9525889 ATGGAGAAAGAGCTGTGTCTGGG - Intronic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172835967 20:37873252-37873274 ATGAAGGCACAGTCGTGGCTTGG + Intergenic
1173475438 20:43355882-43355904 TTCAAGCCACAGCTGTGGCTGGG + Intergenic
1175203351 20:57292604-57292626 ATGTGGACAAAGCTGTGTCTGGG - Intergenic
1175661067 20:60812947-60812969 ATGTACACACAGCTCTATCTTGG - Intergenic
1176249393 20:64113069-64113091 GTGTGGACACACATGTGGCTGGG + Intergenic
1178707136 21:34885672-34885694 ATCAAGACCCAGCTGAGGCTTGG + Intronic
1180255887 21:46627225-46627247 ATGAAGAAACACCTGAGGCTGGG + Intergenic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1183267035 22:36834283-36834305 ATGTACCCACTGCTGTGGATTGG - Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
1184793802 22:46719374-46719396 ATGTGGACACATCCCTGGCTGGG + Intronic
949339926 3:3018525-3018547 ATGGAGACATGGCTGTGGGTGGG + Intronic
949384700 3:3488226-3488248 ATGTAGATACAGCAGAGACTGGG + Intergenic
949706229 3:6820483-6820505 ATGTAGAGATAGCTGTTCCTAGG - Intronic
950969800 3:17174885-17174907 ATGTAAAAACAGTTCTGGCTGGG - Intronic
953116788 3:40000589-40000611 ATCTTTACACAGCTGTGCCTGGG + Intronic
953776024 3:45818292-45818314 ATTTAAAGGCAGCTGTGGCTTGG + Intergenic
953826754 3:46259917-46259939 ATGAAGACATACCTGTGACTGGG + Intronic
954996699 3:54888345-54888367 AAGTAGAGAGAGCTGTGGCGAGG - Intronic
957042166 3:75344072-75344094 ATGTAGACAAAGCTGTTAATAGG + Intergenic
957922977 3:86771764-86771786 ATGGATGCACAGCTGTGGTTTGG - Intergenic
960785638 3:121370532-121370554 ATAGAGACACACCTGAGGCTGGG - Intronic
964246489 3:154659820-154659842 AGGTATGCAGAGCTGTGGCTGGG + Intergenic
964717034 3:159733338-159733360 ATGTATATACAGCTGGGGTTGGG + Intronic
965095264 3:164217491-164217513 ATGTAGCCACAACTGTGTTTGGG + Intergenic
966263034 3:178002666-178002688 AAGTAGGCACAGCTCTGGCCTGG + Intergenic
968717168 4:2168975-2168997 GTGAAGAAACAGCTGTGACTTGG + Intronic
968797082 4:2714323-2714345 ATGTGGAGCCTGCTGTGGCTGGG + Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972063329 4:34909247-34909269 ATAAAGACACACCTGGGGCTGGG - Intergenic
972323866 4:37996783-37996805 ATGGTGACAGGGCTGTGGCTGGG + Intronic
972799021 4:42453264-42453286 TTGTATACACAGCAGTTGCTGGG - Intronic
974563317 4:63552066-63552088 ATTAAGACACACCTGAGGCTGGG + Intergenic
974747241 4:66091527-66091549 ATGTTGACACTACTGTGGATGGG + Intergenic
974780030 4:66543139-66543161 ATGTTGACACTGCTGGGGCATGG - Intergenic
976167332 4:82269868-82269890 ATATAGACCCAGGTGTGGGTCGG + Intergenic
976401841 4:84615590-84615612 AGGCAGACACACCTGTGGCAGGG - Intronic
976996124 4:91436754-91436776 ATTTAGATCCATCTGTGGCTTGG - Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
979411627 4:120385697-120385719 ATGAAGACACACCTGAGACTGGG - Intergenic
980370288 4:131861096-131861118 ATAAAGACACAGCTGAGACTGGG + Intergenic
981809625 4:148759066-148759088 AGGTAAACACAGCTGGGCCTGGG - Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
985480198 5:105250-105272 GTGGATTCACAGCTGTGGCTGGG + Intergenic
986500198 5:8390646-8390668 ATGAAGACATAGCTGAGACTGGG - Intergenic
990626812 5:57622706-57622728 TTGTTGACACCGCTGTTGCTGGG + Intergenic
991657245 5:68916218-68916240 ATGTAAAAACAACTCTGGCTGGG - Intergenic
992260756 5:74967815-74967837 ATCTGGACACAGCAGTGTCTGGG - Intergenic
999589319 5:153127099-153127121 AAGTAGACAAAGCTTTAGCTAGG + Intergenic
999686684 5:154109405-154109427 ATTAAAACACAGCTGTGGCCAGG - Intronic
999907329 5:156156331-156156353 ATATTAAAACAGCTGTGGCTGGG + Intronic
1000907634 5:166981779-166981801 AAGTAGACAGAGGGGTGGCTGGG - Intergenic
1003477269 6:6495001-6495023 CTGTAGTCACACCTCTGGCTAGG + Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005259640 6:24044438-24044460 CTGTAGAAACAACTTTGGCTTGG + Intergenic
1006107890 6:31727726-31727748 AGGCAGACACAGCTGTGGAGAGG - Intronic
1006541847 6:34746378-34746400 GTGTAAACATAGCTGTGGCTGGG - Intergenic
1006816001 6:36850405-36850427 GCGTAGAGACAGCTGAGGCTAGG + Intergenic
1007050478 6:38823324-38823346 ATGTAGACCCAGCTGTATTTCGG + Intronic
1007358899 6:41341602-41341624 AATTAGACACACCTGTGGCCTGG - Intronic
1007450553 6:41938356-41938378 AGAGAGAGACAGCTGTGGCTGGG - Intronic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1015824026 6:137292985-137293007 ATATAGACATACCTGAGGCTGGG - Intergenic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1017048435 6:150368916-150368938 ATGCAGACACAGGTGTGCCAGGG - Exonic
1017776210 6:157682748-157682770 AGGTAGAAATAGCAGTGGCTGGG - Intergenic
1020586637 7:10078485-10078507 GGGTAGCCACAGCTGTAGCTGGG - Intergenic
1020906527 7:14070322-14070344 ATGAAGAAACACCTGAGGCTGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1024384745 7:48738681-48738703 ATGTAAACACCCCTGAGGCTTGG - Intergenic
1024424862 7:49213528-49213550 ATAAAGACATAGCTGAGGCTGGG + Intergenic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1028084122 7:86616033-86616055 ATGAAGACATACCTGAGGCTGGG - Intergenic
1029067782 7:97869479-97869501 ATGCAGAGACAGATGTGGCATGG - Intronic
1029893440 7:103956130-103956152 ATGTAGATAAAGCAGTAGCTAGG - Intronic
1030559207 7:111064061-111064083 ATGAAGACATACCTGAGGCTGGG + Intronic
1031850263 7:126854549-126854571 ATGTAGAAGCAGCTGGTGCTGGG + Intronic
1031858301 7:126948382-126948404 ATGTACACACAGATGTGTTTGGG + Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032591329 7:133194454-133194476 ATGGAGCCACAGCCCTGGCTGGG + Intergenic
1033274933 7:139964639-139964661 TAGTAGACACAGCAGAGGCTAGG + Intronic
1033690606 7:143732950-143732972 CTGTAGATACAGCTGTGAATAGG - Intergenic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1035477032 7:159151111-159151133 CTGTGGCCACAGCTGTGTCTCGG + Intergenic
1035715123 8:1748150-1748172 ATATAGACACAGCTGTGATATGG + Intergenic
1037153420 8:15669066-15669088 ATGTAGACAGAGCTTTGCCAGGG + Intronic
1037609454 8:20464076-20464098 GGGTGGACACAGCAGTGGCTGGG + Intergenic
1037661259 8:20928732-20928754 ATGTAGACTCAGTTGTGTTTTGG + Intergenic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1038600185 8:28932777-28932799 ATTTAGGCAGAGGTGTGGCTAGG + Intronic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1041223666 8:55676508-55676530 ATGTACACACAGCACTGGGTGGG + Intergenic
1041826298 8:62099559-62099581 ATGTACACACTTCTGTGGGTTGG - Intergenic
1042417874 8:68545387-68545409 ATAAAGACACACCTGTGACTAGG - Intronic
1043087086 8:75848870-75848892 AGGTAGTCACAGCCCTGGCTTGG + Intergenic
1043714584 8:83466288-83466310 ATATAGACATACCTGAGGCTGGG - Intergenic
1044528254 8:93276881-93276903 ATGTAGATAGAGGAGTGGCTAGG + Intergenic
1045048360 8:98300711-98300733 TTGGAGGCACAGGTGTGGCTGGG + Intergenic
1047041314 8:120999217-120999239 ATATAGAAACACCTGAGGCTGGG - Intergenic
1047973394 8:130106496-130106518 ATGCATACACAGCTGTGTCTGGG + Intronic
1048265855 8:132985218-132985240 ATGCAGACAAAGCTGTGTGTAGG + Intronic
1048323352 8:133419041-133419063 ATGTGGACACTCCTGTGGATTGG + Intergenic
1048486307 8:134850951-134850973 ACTCAGACCCAGCTGTGGCTTGG - Intergenic
1048550914 8:135432971-135432993 AGGTACACAGATCTGTGGCTCGG - Intergenic
1049116096 8:140688977-140688999 AGATATAGACAGCTGTGGCTGGG + Intronic
1049794444 8:144490137-144490159 GTGTGGACACCGCTGTGGGTTGG + Exonic
1052087809 9:24290081-24290103 ATAAAGACATACCTGTGGCTGGG + Intergenic
1052409077 9:28099571-28099593 AAGTAGATACAGTGGTGGCTTGG - Intronic
1053366741 9:37528183-37528205 ATGTAGACCAAGCTGAGGCGGGG - Intronic
1053515057 9:38723437-38723459 ATCTAGACACTGCTATGGCTGGG - Intergenic
1053634871 9:39987582-39987604 ATAAAGACACAGCTGAGACTGGG + Intergenic
1053771055 9:41476752-41476774 ATAAAGACACAGCTGAGACTGGG - Intergenic
1054209016 9:62263115-62263137 ATAAAGACACAGCTGAGACTGGG - Intergenic
1054315795 9:63585024-63585046 ATAAAGACACAGCTGAGACTGGG + Intergenic
1054549789 9:66388557-66388579 ATAAAGACACAGCTGAGACTGGG - Intergenic
1054913973 9:70479102-70479124 ATGTAGCTACAGCTGTGGTGTGG + Intergenic
1056218269 9:84426054-84426076 ATAAAGACACAGATCTGGCTGGG + Intergenic
1057274719 9:93670240-93670262 ATGCAGTGACAGGTGTGGCTGGG + Intronic
1058211711 9:102177456-102177478 AGGGAGACAAAGCAGTGGCTAGG - Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059445412 9:114334895-114334917 CTGTGGGCACAGCTGTGGTTTGG - Exonic
1060955422 9:127635513-127635535 TCGGAGACACAGATGTGGCTGGG + Intronic
1061022780 9:128027005-128027027 ATGTGAACACAGCTGTGTCTGGG - Intergenic
1061387732 9:130300347-130300369 CTGTAGACACAGCAGTGGGCAGG + Intronic
1062184859 9:135212768-135212790 ATGCATAAAAAGCTGTGGCTGGG - Intergenic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1188087221 X:25914382-25914404 ATGTTGACAGAGCTCTGCCTTGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1192360458 X:70435516-70435538 ATGTGGACTGAGCAGTGGCTGGG + Intergenic
1192858687 X:75041737-75041759 ATGCAGCAAAAGCTGTGGCTAGG - Intergenic
1195367319 X:104138904-104138926 AGGCAGACACACATGTGGCTGGG - Intronic
1196559200 X:117125754-117125776 ATGTAGACATACCTGAGGCTGGG - Intergenic
1198996257 X:142577493-142577515 ATGAAGACATACCTGAGGCTGGG - Intergenic