ID: 1107285135

View in Genome Browser
Species Human (GRCh38)
Location 13:38781966-38781988
Sequence GGGCAAAAGCAGAGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107285135_1107285141 6 Left 1107285135 13:38781966-38781988 CCTGGCCCACTCTGCTTTTGCCC 0: 1
1: 0
2: 1
3: 40
4: 346
Right 1107285141 13:38781995-38782017 TTCCTTCCTGTATTCCCCATTGG 0: 1
1: 0
2: 1
3: 39
4: 281
1107285135_1107285145 20 Left 1107285135 13:38781966-38781988 CCTGGCCCACTCTGCTTTTGCCC 0: 1
1: 0
2: 1
3: 40
4: 346
Right 1107285145 13:38782009-38782031 CCCCATTGGCCGACCCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107285135 Original CRISPR GGGCAAAAGCAGAGTGGGCC AGG (reversed) Intronic
900255728 1:1697550-1697572 GGGGGAAAGCAGGGTGGGGCAGG - Intronic
900341122 1:2189854-2189876 CGGCAGGAGCAGAGAGGGCCCGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901513156 1:9728098-9728120 AGACAATGGCAGAGTGGGCCGGG - Exonic
901813325 1:11779825-11779847 GGGCAACAGCCCAATGGGCCTGG + Exonic
901917093 1:12508175-12508197 GGGCAGAAGTATAGTGGGCGAGG - Intronic
903649491 1:24914197-24914219 TGGGAAAAGCAGAGTCGGGCAGG + Intronic
903817290 1:26073610-26073632 AGACAAAAGAAGCGTGGGCCAGG - Intergenic
903977630 1:27161466-27161488 AGTCAAAAGCAGTGTGGGCCTGG - Intronic
904318395 1:29680778-29680800 TGGAGAAAGCAGTGTGGGCCGGG - Intergenic
904454278 1:30637869-30637891 GGACAAAAGCTAAGTGGACCAGG - Intergenic
904750233 1:32737333-32737355 GGGCAACATCAGGGTGGTCCTGG + Intergenic
905187568 1:36207540-36207562 GGCCAAAAGCAGAGGTTGCCAGG - Intergenic
905270300 1:36783222-36783244 GGGCAAAAGCTGAGTGAGCAAGG + Intergenic
905804443 1:40865571-40865593 GGGCAAAAGCGGGCTGGGCGTGG + Intergenic
905998379 1:42401924-42401946 CGTCTAAAGCACAGTGGGCCAGG + Intronic
906074771 1:43043949-43043971 GGAAAAAAGCACAGTGGGCTGGG + Intergenic
906388527 1:45393185-45393207 GGTCAAAATAATAGTGGGCCTGG - Intronic
907942420 1:59101784-59101806 GGTCACATGCAGAGTGGTCCTGG - Intergenic
908004841 1:59717382-59717404 GGGCAGTATCAGAGTGGTCCAGG - Intronic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910239974 1:85075766-85075788 GGCAATAAGAAGAGTGGGCCTGG - Intronic
911180929 1:94859658-94859680 GAGGGAAAGCAGAGAGGGCCTGG + Intronic
916211842 1:162366092-162366114 GGGCAATAGCAGAGGTTGCCTGG + Intronic
916582288 1:166119846-166119868 GGGCAGAAGCTCTGTGGGCCTGG - Intronic
916947983 1:169748551-169748573 GGGCAAAAGCAGAGTAGATTTGG + Intronic
916990467 1:170238099-170238121 GGGCAGGAGCACAGTGGGCCGGG + Intergenic
917644453 1:177016580-177016602 GGGCAAAAGAAGAGAGTACCAGG + Intronic
920910983 1:210216481-210216503 GAGCAAAACCACAGTGTGCCAGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922985398 1:229862369-229862391 AGGCAAAGGCAGAGTGGGAAGGG + Intergenic
923429254 1:233905055-233905077 AGGCAAAGACAGAGTGGGACCGG - Exonic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
1063186020 10:3652241-3652263 GAGCAGCATCAGAGTGGGCCTGG + Intergenic
1063647045 10:7895602-7895624 GGGTAAAAGCAGAGGGCTCCAGG + Intronic
1064059165 10:12122897-12122919 TGGTAAAAGTAGAGAGGGCCTGG - Exonic
1065845952 10:29743551-29743573 AGGCAAAAGCCAAGTGGGCTGGG - Intergenic
1065925515 10:30431809-30431831 CGGCAGAAGCAGCCTGGGCCGGG - Intergenic
1066044386 10:31583117-31583139 GGGCAAATGCAGAGAGACCCTGG - Intergenic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1067410273 10:46058394-46058416 GTGTAAAAGCAGTGTTGGCCCGG - Intergenic
1067796861 10:49327158-49327180 AGGGAAGAGCAGGGTGGGCCAGG - Exonic
1069415470 10:68196778-68196800 AGGCAAAGGGAGAGGGGGCCAGG - Intronic
1069747396 10:70724466-70724488 GGGCCAAGGCAGACAGGGCCAGG + Intronic
1070772050 10:79088287-79088309 CGGCAACAGCAGCCTGGGCCAGG + Intronic
1072517722 10:96202307-96202329 TGGCAACAGCAGAGTGGGGGAGG + Intronic
1072691716 10:97576368-97576390 GGGCAAATGCAGAGAAGACCTGG + Intronic
1072819108 10:98538627-98538649 CAGCAAAAGCAGAGTTGGCAGGG - Intronic
1073268401 10:102241797-102241819 GGGCGAGAGTAGAGTGGTCCCGG + Intergenic
1073478259 10:103768509-103768531 GGGCCAGAGCACAGAGGGCCTGG + Intronic
1074233580 10:111562099-111562121 GGGCAAAAGCAGGCTGGGGAAGG + Intergenic
1074888760 10:117717449-117717471 GGACCAAGGCAGAGTGTGCCTGG - Intergenic
1075581943 10:123625506-123625528 GGGCAAAAGCTCAGAGGGCCTGG + Intergenic
1076342013 10:129755719-129755741 AGGCAACAGCAGAGCTGGCCAGG - Intronic
1076797451 10:132805141-132805163 GGGCCACAGCAGAGTGGGCTGGG - Intergenic
1076883915 10:133252595-133252617 GGTCAGGAGCAGAGTGGGACAGG - Intergenic
1076947873 10:133664629-133664651 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076948863 10:133667939-133667961 GGGCAAAAGCCGGGAGGACCGGG + Exonic
1076949847 10:133671238-133671260 GGGCAAAAGCCGGGAGGACCGGG + Intronic
1076950831 10:133674537-133674559 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076951821 10:133677847-133677869 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076952810 10:133681157-133681179 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076953794 10:133684456-133684478 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076954778 10:133740808-133740830 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076955767 10:133744118-133744140 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076956757 10:133747428-133747450 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076957744 10:133750737-133750759 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076958729 10:133754036-133754058 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076959718 10:133757346-133757368 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1076960702 10:133760645-133760667 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
1077389670 11:2294395-2294417 CGGCAAAAGCACCGTGGGCAAGG + Intergenic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1081427250 11:42938841-42938863 TGGCTAGAGCAGAGTTGGCCAGG - Intergenic
1081691671 11:45082538-45082560 GAGCAAGATCAGAGTGGGCCAGG + Intergenic
1083310151 11:61779800-61779822 GTGCAAATGCAAAGAGGGCCAGG - Intronic
1083590222 11:63889329-63889351 GGCCAGAAGCAGAGTAAGCCAGG - Intronic
1083630619 11:64093394-64093416 GGGCAAGGGCTGAGTGAGCCGGG + Intronic
1083894733 11:65614186-65614208 GGGCCAAAGGAGACGGGGCCAGG - Exonic
1084181687 11:67450097-67450119 GGGCAAAGGCAAAGACGGCCGGG - Intergenic
1085034779 11:73293293-73293315 GGGCAAGGGCAGAGTGGCCCTGG + Intronic
1085302661 11:75467547-75467569 GGAGAAAAGCTGAGTGGGCTGGG + Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085389414 11:76174976-76174998 TGGGAAGAGCAGGGTGGGCCTGG + Intergenic
1086053108 11:82617250-82617272 GTGCAAAAGCAGACTGGGCTTGG - Intergenic
1086406179 11:86500731-86500753 AGGCAAATTCAGAGTGTGCCTGG - Intronic
1086416790 11:86596901-86596923 GGGCCAAACCAAAGTGGACCAGG + Intronic
1087475577 11:98629686-98629708 GGTAAAAAGCAGAATAGGCCAGG - Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088910036 11:114183782-114183804 CTCCAAGAGCAGAGTGGGCCTGG - Intronic
1089391471 11:118104829-118104851 GGGAAAAAGGAGAGAGGCCCAGG - Intronic
1089757232 11:120695875-120695897 GGACAAGACCAGAGTGGGCCTGG + Intronic
1091068006 11:132535426-132535448 AGGCAGAAGAAAAGTGGGCCTGG + Intronic
1092076903 12:5681448-5681470 AGGCCAAAGCAGAGTGTCCCAGG + Intronic
1092449453 12:8588159-8588181 GGGCAAAAGAAGGGATGGCCTGG + Intergenic
1092857097 12:12684566-12684588 GGGCAACAAGAGAGTGGGGCTGG - Intronic
1093870150 12:24281364-24281386 GGGAAAATGCAGATTGGGGCTGG - Intergenic
1096263152 12:50105247-50105269 GGCCAAAAGCAGCCTGGGCTTGG - Intronic
1096309251 12:50505476-50505498 GCGCAGAAGCAGTGTGGGCCCGG - Intronic
1096551177 12:52372780-52372802 TGGCAGAAGCAGAGAAGGCCAGG + Intergenic
1098296550 12:69010193-69010215 GGGCAAAATGAGAGGTGGCCTGG - Intergenic
1098545410 12:71706200-71706222 GGGCAAAAGAATACTGGGCGTGG - Intergenic
1098780105 12:74676352-74676374 TGGGAAAAGCATAGTGTGCCTGG - Intergenic
1101138312 12:101769021-101769043 GGGGAACAGGAGAATGGGCCTGG + Intronic
1101612474 12:106303557-106303579 GGAGAAAAGCCGATTGGGCCTGG + Intronic
1102298674 12:111756114-111756136 AGGCACCTGCAGAGTGGGCCTGG + Intronic
1102597656 12:114005296-114005318 GGGCAGCACCAGAGTTGGCCAGG + Intergenic
1102879041 12:116470212-116470234 AGGCCAAAGCAGAGGGGGTCTGG - Intergenic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1105018278 12:132799356-132799378 TGGAAAAAGCAGTGAGGGCCCGG + Intronic
1105462729 13:20607221-20607243 GGACGAATGCAGACTGGGCCCGG - Intronic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106286692 13:28324249-28324271 AGGCAGAAGCAGAGAGGGACTGG + Intronic
1107285135 13:38781966-38781988 GGGCAAAAGCAGAGTGGGCCAGG - Intronic
1109183757 13:59245739-59245761 GTGAAAAAGAAGAGTAGGCCGGG + Intergenic
1112751764 13:102590361-102590383 GGGCAAAACAAAAATGGGCCAGG - Intergenic
1112898935 13:104335970-104335992 GAGCAAGAGCAAAGTGAGCCTGG - Intergenic
1113444435 13:110354888-110354910 CGGCAGTGGCAGAGTGGGCCTGG + Intronic
1113465532 13:110510184-110510206 GGACAAAAGAAGGGTGAGCCAGG - Intronic
1113607373 13:111619950-111619972 AGCAAAAAGCAGAGTGGACCGGG - Intronic
1113877631 13:113604564-113604586 GGGCAACAGCAAAGTGGCCTCGG - Intronic
1114678095 14:24459008-24459030 GGGCCAAGGCAGAGTGGGATGGG + Intergenic
1115905892 14:38202617-38202639 GGGCAAAAGGAGACAGGGGCAGG + Intergenic
1116425086 14:44781168-44781190 GGTGAAAAACAGAGTGGGCTGGG + Intergenic
1118526843 14:66653941-66653963 GTGCAATAGCAGAGTTGGCATGG + Intronic
1118818696 14:69330684-69330706 GGGTGAAAGCAGAGTGGGGAAGG + Intronic
1119594099 14:75917813-75917835 GGGGAAAAGCCGAGAGGGCTTGG + Intronic
1120260796 14:82182838-82182860 AGGAAAATGCAAAGTGGGCCTGG - Intergenic
1120349946 14:83342566-83342588 GGGTATGGGCAGAGTGGGCCTGG + Intergenic
1120701623 14:87704860-87704882 TGGAAGAAGCAGAGTTGGCCTGG - Intergenic
1121520491 14:94583037-94583059 TGGGAAAAGAAGAGTGAGCCTGG + Intronic
1122578222 14:102755227-102755249 GGGCCTAAGGAGAGTGGGTCTGG - Intergenic
1122771972 14:104101597-104101619 GGGCCCCAGCAGAGTGGGCCGGG - Intronic
1123062161 14:105599297-105599319 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1123086906 14:105721025-105721047 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1202848529 14_GL000225v1_random:1381-1403 GGGCAAAAGCTGGGAGGACCGGG + Intergenic
1202922025 14_KI270723v1_random:35456-35478 GGGCAAAAGCTGGGAGGACCGGG + Intergenic
1202922903 14_KI270724v1_random:2157-2179 GGGCAAAAGCTGGGAGGACCGGG - Intergenic
1123421377 15:20139815-20139837 GGGCAAAGCCAGGGTAGGCCAGG + Intergenic
1123530603 15:21146355-21146377 GGGCAAAGCCAGGGTAGGCCAGG + Intergenic
1123715791 15:23029897-23029919 GGGGAAGAGCAAAGTGGGCTGGG + Intronic
1123867078 15:24531708-24531730 GGAAAAAAGCAGAGAGGGCTAGG + Intergenic
1124707098 15:31975197-31975219 GGGCTACACCAGAGTGGGTCAGG - Intergenic
1127953912 15:63835823-63835845 GGGCAAAACCAGGCTGGGCACGG - Intergenic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128682601 15:69662599-69662621 GGGCAGGAGCAGAGAGGGGCTGG + Intergenic
1130770595 15:86919907-86919929 GGCCCATGGCAGAGTGGGCCAGG - Intronic
1131351269 15:91702281-91702303 GGCCAAATGCACAGTGGGACTGG - Intergenic
1131445472 15:92495225-92495247 GGGCAAGGGCAGAGTGGGGGTGG - Intronic
1131798630 15:96046572-96046594 GGGCCACAGCAGAGTGAGCGAGG + Intergenic
1132678376 16:1130019-1130041 GGGCGCAAGCAGAGTTGGGCAGG - Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1135685344 16:24494293-24494315 GGGCAGAAACAGAGTTGGACTGG + Intergenic
1136477341 16:30521713-30521735 AGGCAGAGGCAGAGTGGCCCTGG - Exonic
1136515896 16:30768187-30768209 GGGAAAGAGGAGGGTGGGCCAGG + Exonic
1137328135 16:47461616-47461638 GGGCACACGCAGAGTGGAGCTGG - Intronic
1138494493 16:57399347-57399369 GGGCAACAGCAGTGGTGGCCTGG + Intergenic
1139204639 16:65015487-65015509 GAGAAAAAGCAGAGAGGGCAGGG + Intronic
1141622016 16:85241368-85241390 GGGCAGAGACAGAGAGGGCCTGG - Intergenic
1142342153 16:89530807-89530829 AGGTGAAAGCAGCGTGGGCCGGG + Exonic
1142947348 17:3442557-3442579 GGGGGAAAGCATAGTGGGCTGGG - Intronic
1144384065 17:14732463-14732485 AGGCAAAAGCTCAGTGAGCCAGG - Intergenic
1144831217 17:18132258-18132280 GGGCAGAAGCAGAGGTGCCCTGG - Intronic
1145121348 17:20263086-20263108 GGGCAGAGGCAGAGTGGACAGGG - Intronic
1146465132 17:33080188-33080210 GGGCCAAGGCAGAGTGGGCAGGG + Intronic
1146915072 17:36673140-36673162 GAGGACAAGCAGAGTGGGCCTGG + Intergenic
1148463979 17:47853595-47853617 GGGAAAAGGCAGAAGGGGCCAGG - Intronic
1148748669 17:49932209-49932231 GGGCAGAGCCAGGGTGGGCCAGG - Intergenic
1148779430 17:50113106-50113128 GGGCAAAAGGAGCCTGGGCGTGG - Intronic
1150598924 17:66633109-66633131 GCCCAAATGGAGAGTGGGCCAGG + Intronic
1153459170 18:5314728-5314750 GGTCAGAAGCAGAGAGGGACTGG + Intergenic
1153977126 18:10279402-10279424 GAGAAAAATCAGAGCGGGCCTGG - Intergenic
1154299999 18:13184557-13184579 GGGGACGAGCAGTGTGGGCCGGG + Intergenic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1157570173 18:48706986-48707008 GGGGAAAAGCAGGCAGGGCCTGG + Intronic
1159012912 18:63075202-63075224 GGGCAAAGGCGGTGTGGTCCCGG - Intergenic
1159362089 18:67418504-67418526 GGTAAAAAGTAGCGTGGGCCGGG + Intergenic
1160383405 18:78478054-78478076 AGGCAAAATGAGAGTGGGCAAGG + Intergenic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1160501461 18:79403149-79403171 GGGCCACAGCGGCGTGGGCCAGG - Intronic
1160510891 18:79452699-79452721 GGGTTCAGGCAGAGTGGGCCTGG + Intronic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1161037712 19:2094873-2094895 CGAAAAAAGCAGTGTGGGCCGGG + Intronic
1161194463 19:2978325-2978347 GGGCAGAACCACATTGGGCCCGG - Intronic
1161335062 19:3708570-3708592 GTGGAAAAGCACAGTGGGGCGGG - Intronic
1161735930 19:5992035-5992057 GGGCAAAGGCCGAGTGTCCCTGG + Intergenic
1162952915 19:14082436-14082458 GGGCAATAGCAACGTGGGCCTGG - Intronic
1163513980 19:17751860-17751882 GGGCAAAATCACAGTCAGCCGGG + Intronic
1165316053 19:35055992-35056014 AGGCCAGAGCAGAGTGAGCCAGG - Intronic
1165915349 19:39255277-39255299 GGGCAAGTGCACAGTGGTCCTGG - Intergenic
1165999630 19:39870679-39870701 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999723 19:39870950-39870972 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1166264571 19:41670994-41671016 GGGAAAAAGCAGGGTGGGCCTGG - Intronic
1166730841 19:45058168-45058190 GGGCAAAGGCAGAGAGAGGCCGG - Intronic
1166950286 19:46422693-46422715 TAGAAAAGGCAGAGTGGGCCAGG + Intergenic
1167220622 19:48196179-48196201 GGTCAAAAGAAGAAGGGGCCTGG + Intronic
1167514935 19:49917733-49917755 GGTAGAAAACAGAGTGGGCCAGG + Intronic
1168078740 19:53994046-53994068 GGGCACATGCAGAGTGGGCACGG - Intronic
1168151796 19:54453027-54453049 GGGCAAAGCGAGAGCGGGCCTGG - Intronic
925947322 2:8877872-8877894 GGGCTGGAGCAGAGTGGACCCGG + Intronic
926199044 2:10780294-10780316 GTGCAAAGGCGGAGTGGACCGGG - Intronic
926933968 2:18068166-18068188 GGGCAGAAGCAGAGAGGGGTGGG - Intronic
928235656 2:29537311-29537333 GGGCAACAGCACCCTGGGCCTGG - Intronic
929732753 2:44513273-44513295 GGGCCAAAGGAGAGGGGGACTGG + Intronic
929766526 2:44848336-44848358 GGGAAAGAGCAGAGTGAGCCTGG + Intergenic
929971433 2:46580529-46580551 GGGAAAAAGCAGAGTGAGGGAGG - Intronic
930020049 2:46996207-46996229 GGGCACAGGAAGAGTGGGGCAGG + Intronic
931247400 2:60503105-60503127 GGACAAATGCAGAGTGGATCTGG - Intronic
931496110 2:62808995-62809017 TGGTAAGAGCAGAGTAGGCCAGG + Intronic
931849975 2:66243335-66243357 GGACAAAGTCAGATTGGGCCAGG - Intergenic
932055065 2:68435000-68435022 TGGCAAAAGCACAGTGGGCATGG + Intergenic
932307807 2:70716302-70716324 GGGCAAATGCAGAGAGGTCAGGG - Intronic
934239003 2:90251857-90251879 GGGCACAAGCAGAGCAGGCTAGG - Intergenic
934864988 2:97800452-97800474 TTATAAAAGCAGAGTGGGCCGGG + Intronic
935136679 2:100310280-100310302 GGGCAAAGGTAGAGTGAGCCAGG - Intronic
937375627 2:121333954-121333976 GGGCAACTGCTCAGTGGGCCTGG - Intergenic
940278235 2:151962012-151962034 GTGCAATAGCAGAGTGGGGAAGG - Intronic
944183918 2:196926897-196926919 GGGAGAAAGCAGGGTGGGCTGGG + Intronic
944480184 2:200149254-200149276 TGGCTAAAGCTGATTGGGCCAGG + Intergenic
944802364 2:203248728-203248750 GGGCAAAAGCTGGGCGGGGCGGG - Intronic
946947284 2:224833945-224833967 AGAAAAAAGTAGAGTGGGCCAGG - Intronic
1171205456 20:23275629-23275651 GGACAACAGCAGAGTTGGCCTGG - Intergenic
1171886888 20:30660498-30660520 GGGGAGGAACAGAGTGGGCCAGG - Intergenic
1172438770 20:34950472-34950494 GGGCAAAAGGAGGCTGGGCACGG + Intronic
1173500182 20:43547602-43547624 TGCCAAAAGCAGAGGGGGGCAGG - Intronic
1173690764 20:44959565-44959587 GGGTCAAAGCATAGTGAGCCAGG - Intronic
1174236117 20:49093619-49093641 AGAAAAAAGCAGAGAGGGCCAGG + Intronic
1174556360 20:51398248-51398270 GGGGAACAGCAGAGTGGGCAGGG - Intronic
1174827597 20:53782564-53782586 GAGAAAAAGCACAGTGGGCTTGG - Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178815325 21:35924110-35924132 GGGCAGAAGGAGAGTTTGCCAGG + Intronic
1180953289 22:19730347-19730369 GGGCAAAGGCATGGAGGGCCTGG - Intergenic
1181354806 22:22291557-22291579 GGGCACAAGCAGAGCAGGCTAGG + Intergenic
1181588385 22:23867087-23867109 GGGCAAAAGCAGGGTGGGAGGGG + Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1182886080 22:33775447-33775469 GGGGAAAAGCAGAGTTGGTGTGG - Intronic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1182997947 22:34831709-34831731 AAGAAAAAGCACAGTGGGCCGGG + Intergenic
1183356284 22:37361506-37361528 GGGCAGGAGCAGGGTGGGCTTGG - Intergenic
1183762312 22:39832973-39832995 GTGCAGAAGCCGAGTGGGCAAGG + Intronic
1183839389 22:40485510-40485532 GGGCAAAAGGAAAGGGGGGCAGG + Intronic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184411281 22:44327792-44327814 GGGCATAACCAGGGTGGGCAGGG + Intergenic
1184622419 22:45691598-45691620 GCTCAAAAGCAGTCTGGGCCAGG + Intronic
1184675553 22:46040782-46040804 GGTCGAATGCAGAGTGGGCTGGG + Intergenic
1185071917 22:48661315-48661337 GGGCACAAGGAGAGAGGGCTGGG - Intronic
1185204809 22:49531756-49531778 GAGGAAGAGCAGAGTGTGCCGGG - Intronic
949957340 3:9279829-9279851 TGGCAAATGCAGAGGGTGCCAGG + Intronic
950685994 3:14619015-14619037 GGGAAAAAACAGCGTGGGTCTGG - Intergenic
950867014 3:16197306-16197328 GGGCAGAAGGGGAGTTGGCCAGG - Intronic
952026814 3:29092723-29092745 GTGCCAAAACAGAATGGGCCTGG - Intergenic
952976976 3:38704901-38704923 GGCCAAAAGCAAGCTGGGCCTGG + Intronic
952996997 3:38894298-38894320 GAGCAAAATCAGAGTGGGCTGGG - Intronic
953606582 3:44416715-44416737 GGGCACCAGGACAGTGGGCCAGG - Intergenic
954147861 3:48643098-48643120 GGGTCAAAGCAGAGTCGGCAGGG + Intronic
954161596 3:48726748-48726770 AGGTAAAAGCAAAGAGGGCCTGG + Intronic
954873673 3:53786718-53786740 GGGCAGGGGCAGAGTGGGGCGGG - Intronic
955520484 3:59770867-59770889 GGGCAGAAGCAGAGTGGCACAGG - Intronic
957224815 3:77429943-77429965 TGGTCACAGCAGAGTGGGCCAGG - Intronic
959500787 3:107103802-107103824 GCTCAAAAGCAGAAGGGGCCAGG - Intergenic
961353197 3:126316765-126316787 GTGCACAGGCAGAGTGGGGCTGG + Intergenic
962184528 3:133243942-133243964 GGGGAAAAGGGTAGTGGGCCTGG + Intronic
962684419 3:137833347-137833369 GGGCAAAAGAAGAATGTTCCTGG - Intergenic
962753384 3:138450897-138450919 GGTCAGATTCAGAGTGGGCCTGG - Intronic
964503191 3:157370666-157370688 GGGCAAAAGCAGAGATGGGCAGG + Intronic
964726723 3:159821337-159821359 GGGAAAATGTAGAGAGGGCCAGG + Intronic
965458903 3:168936816-168936838 GGGCACAAGCAAAGTAGGCTGGG + Intergenic
965553543 3:169996528-169996550 GGGCAAGAGCAGAGTGGAGCTGG - Exonic
968027080 3:195451497-195451519 AGGCAAAAGCAGAGTTGGTGAGG + Intergenic
968223760 3:196959190-196959212 GGGCAAAATAAGAGTGGGCGAGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
968923142 4:3532888-3532910 GGGCAGAAGCGGGCTGGGCCAGG - Intergenic
968963339 4:3756744-3756766 GGGAAAAGGCAGAAGGGGCCAGG + Intergenic
970454776 4:16212286-16212308 GGGCAAAAGCTGATTGTGGCTGG + Intronic
970975867 4:22042237-22042259 GTGCAAAAGCATTGTGGGCAGGG + Intergenic
973602149 4:52552598-52552620 GGTCAAAAGCACAGGAGGCCTGG + Intergenic
976385741 4:84455882-84455904 TAGCAACAACAGAGTGGGCCAGG - Intergenic
980283484 4:130752978-130753000 TGCCAAAGGCAGAGTGGACCTGG + Intergenic
982377966 4:154715446-154715468 GGGCAAGAGCAAAGTGGGAGAGG - Intronic
984093831 4:175409685-175409707 GGGCAAGAGCAGGGTTGGCTGGG - Intergenic
985446055 4:190021855-190021877 GGGCAAAAGCCGGGAGGACCGGG - Intergenic
985451327 4:190065430-190065452 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
985452317 4:190068723-190068745 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
985453302 4:190072020-190072042 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985454292 4:190075313-190075335 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985455280 4:190078606-190078628 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985456268 4:190081906-190081928 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985457252 4:190085200-190085222 GGGCAAAAGCCGGGAGGACCGGG + Intergenic
985458239 4:190088493-190088515 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985459228 4:190091793-190091815 GGGCAAAAGCCGGGAGGACCGGG + Exonic
985463480 4:190174562-190174584 GGGCAAAAGCCGGGAGGACCGGG + Exonic
986302018 5:6484770-6484792 GGGAACAAGCAGAGAGGGCTGGG - Intronic
987033157 5:13994215-13994237 GGTCAAAGGCAGAGTGAGCATGG - Intergenic
987045663 5:14105439-14105461 GTTCAAAGGCAGATTGGGCCGGG + Intergenic
989178412 5:38553057-38553079 AGGCAGAAGAAGAGTGGGCTGGG - Intronic
990669808 5:58115437-58115459 GGGCAGAAACAAAGAGGGCCTGG - Intergenic
994908310 5:105868760-105868782 GGGCAAAGCCAGACTGGGGCTGG + Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995998829 5:118333242-118333264 GGGGAAAAGCCAAGTGGGGCTGG - Intergenic
996183388 5:120448571-120448593 AGGCAAAAGTAGTGTGGTCCAGG + Intergenic
997290264 5:132727405-132727427 GGGAAAAAGGAGAGGGGGTCAGG + Intronic
997373845 5:133383110-133383132 GGACAAAATCAGGGTGGGCCGGG - Intronic
997882429 5:137602596-137602618 GGTCAAAAGCAGAGGCTGCCTGG + Intergenic
1000802713 5:165748440-165748462 GGTAAAAAGCACAGTGTGCCAGG - Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1003344337 6:5252700-5252722 GAGCAAAAGCAGAGTCCTCCTGG + Intronic
1003567196 6:7231239-7231261 TGGCAAAAGCAGCGGGGGCTTGG - Exonic
1003823327 6:9924855-9924877 GAGCAAAGGCAGAGCAGGCCAGG + Intronic
1003858846 6:10303472-10303494 GGGCAACAGCTGAGTACGCCAGG + Intergenic
1006239379 6:32664589-32664611 GGGGACAAGCAGAGTTGGCCAGG - Intronic
1008703780 6:54132829-54132851 GGGCGCAAGCTGAGTGGGGCTGG - Intronic
1013162614 6:107560479-107560501 GGGGAAAGGGAGGGTGGGCCTGG - Intronic
1013231616 6:108165991-108166013 GGGGAAAAGCTAAGTGGGCCAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1015948449 6:138526556-138526578 GGGTAAAAGTAGAGAGGGCAGGG - Intronic
1018736122 6:166688378-166688400 GGGGATGAGCAGAGGGGGCCGGG - Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1019897666 7:3995263-3995285 AGGCAAAGGCAGAGGGGGACAGG - Intronic
1020022160 7:4875624-4875646 GGGCAAAAAGCGAGTGGGACAGG - Intronic
1021012911 7:15493668-15493690 GGGAAAAAGAAATGTGGGCCGGG - Intronic
1021615449 7:22498823-22498845 GTGGAAAACCAGAGTGGCCCTGG + Intronic
1021816912 7:24456091-24456113 GAGGAAAAGCAGAGTGGGCATGG - Intergenic
1021905221 7:25326634-25326656 GTGCACAAGGAAAGTGGGCCTGG + Intergenic
1023012008 7:35932720-35932742 TTGAAAAAGCAGAGTAGGCCAGG + Intergenic
1024079115 7:45841140-45841162 TTGAAAAAGCAGAGTAGGCCAGG - Intergenic
1024230738 7:47361360-47361382 GGGAGAAAGCATAGTGTGCCAGG - Intronic
1025125661 7:56342811-56342833 TTGAAAAAGCAGAGTAGGCCAGG + Intergenic
1026828836 7:73599714-73599736 GGGCAACAGCAGTTAGGGCCAGG + Intronic
1026913991 7:74108876-74108898 GGGCACAAACAGGCTGGGCCCGG - Intronic
1028377050 7:90155807-90155829 GTGGAAAACCAGAGTGGCCCTGG - Intronic
1029487514 7:100852622-100852644 GGGGAAGAGCAGAGAGGGTCGGG + Intronic
1030391512 7:108933897-108933919 AAGAACAAGCAGAGTGGGCCGGG + Intergenic
1033042078 7:137927980-137928002 GGGGAAAAGCAAAGAGGCCCAGG - Intronic
1034624852 7:152484781-152484803 TGCAAAAAGCAGAGTAGGCCGGG - Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1035000614 7:155609789-155609811 GGGCTGAAGCAGAGCTGGCCAGG - Intergenic
1035510727 8:180075-180097 GGCAAACAGCAGAGTGGCCCTGG + Intergenic
1037684773 8:21129489-21129511 GGACAGAAGGACAGTGGGCCCGG + Intergenic
1039142220 8:34402842-34402864 GGGCAAAATCAGTGAGGGCAGGG - Intergenic
1039898140 8:41730836-41730858 GGGCATAAGCACAGAAGGCCTGG + Intronic
1039991235 8:42489651-42489673 GGGGAAAATCTGAGTGGGGCTGG - Intronic
1041670348 8:60485460-60485482 GGGCAAAGCAAGAGAGGGCCAGG + Intergenic
1045241866 8:100409720-100409742 AGCCATAAGCAGAGTGGTCCTGG + Intronic
1045735621 8:105293281-105293303 GTAAAAAAGAAGAGTGGGCCTGG + Intronic
1047039230 8:120974296-120974318 GGAAAAAAGGAGAATGGGCCAGG + Intergenic
1047360461 8:124164340-124164362 GGGCAAAATCACAGTGGGTTCGG - Intergenic
1048363485 8:133718074-133718096 GGTGAAAAGAAGGGTGGGCCAGG - Intergenic
1049206799 8:141367314-141367336 GGGCAAAGGCAGGGTGGGGGCGG + Intergenic
1049212615 8:141393645-141393667 GGGCAAAGGCAGAGAGGAGCAGG - Intronic
1049403706 8:142442420-142442442 GGGCACCTGCGGAGTGGGCCAGG + Intergenic
1049695896 8:143984139-143984161 GGGCAAGGGCAGAGGAGGCCTGG + Intronic
1050617358 9:7416075-7416097 GGGGCAAAGCAGAGAGGGCTTGG + Intergenic
1052389317 9:27860060-27860082 GGACAAAACCAGATTGGGCCAGG - Intergenic
1052760134 9:32581811-32581833 GAGCTAAAGCACAGTGGGCAGGG + Intergenic
1053013449 9:34648303-34648325 GGGCAAAAGCAGAGAAGAACAGG - Intronic
1056526623 9:87448589-87448611 AGAAAAAAACAGAGTGGGCCGGG + Intergenic
1059436174 9:114277780-114277802 GGGCAAAACCAGAGAGGGCAGGG - Intronic
1059989943 9:119855472-119855494 TGGCAAAGGCAGAGAGGCCCTGG - Intergenic
1060550153 9:124481188-124481210 GGGCCAAAGCAGAACGGCCCGGG - Intergenic
1061299310 9:129695609-129695631 GAGGAAGAGCAGCGTGGGCCAGG - Intronic
1061390003 9:130312213-130312235 GCTCACCAGCAGAGTGGGCCTGG + Intronic
1061816477 9:133200209-133200231 GCGCAAAAGCAGACTGGGCTCGG + Intergenic
1062002179 9:134221885-134221907 GGGCAAAAGCCCAGGAGGCCGGG + Intergenic
1062446884 9:136598895-136598917 GGCCAAAGGCAGTGAGGGCCTGG - Intergenic
1186837679 X:13453689-13453711 GCCCAGAAGCAGAGTGGGACAGG - Intergenic
1186839547 X:13471423-13471445 GAGCTACAGCAGAGTGAGCCTGG + Intergenic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190180391 X:48186942-48186964 GGGCAGAATCGGAGTGGGCAGGG - Intronic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190210425 X:48442279-48442301 GGGCAGAATCGGAGTGGGCAGGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1191169197 X:57423753-57423775 GGGGCAAAGCTGAGTGGGACTGG - Intronic
1195162395 X:102183394-102183416 GAGAGAATGCAGAGTGGGCCTGG - Intergenic
1197263969 X:124346826-124346848 GGGCAACAGCAGCTGGGGCCAGG + Intronic
1197742319 X:129904819-129904841 GGGCAAAAGCAAAATGGGAATGG + Intergenic
1197885794 X:131216964-131216986 GGGCCAAATCAGAGAAGGCCAGG - Intergenic
1200148445 X:153939669-153939691 GGATAAAGGCAGAGTGGGCAAGG - Intronic
1201178174 Y:11322346-11322368 GGGCAAAAGCCGAGAGGACTGGG + Intergenic
1201179757 Y:11333119-11333141 GGGCAAAAGCCGGGAGGACCCGG + Intergenic