ID: 1107288271

View in Genome Browser
Species Human (GRCh38)
Location 13:38821820-38821842
Sequence ATAGACAAACAGCTCCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107288268_1107288271 6 Left 1107288268 13:38821791-38821813 CCCAATCTATAGAGAACTTCGAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG 0: 1
1: 0
2: 1
3: 12
4: 163
1107288269_1107288271 5 Left 1107288269 13:38821792-38821814 CCAATCTATAGAGAACTTCGAGA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107288271 Original CRISPR ATAGACAAACAGCTCCAACA AGG Intronic
900852176 1:5152665-5152687 AGAAGCAAACAGGTCCAACATGG - Intergenic
900866738 1:5274403-5274425 AGGCACAAACAGCTCCAAGAAGG + Intergenic
901582909 1:10260572-10260594 AAACACAAACAGCCCCAGCATGG + Intronic
904357541 1:29950433-29950455 CTAGGCAAAGAACTCCAACATGG + Intergenic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
905039005 1:34937751-34937773 ATAGACAACTAGCTAAAACAGGG + Intergenic
905712749 1:40120396-40120418 ATAGAGAAATAGCTAAAACAGGG - Intergenic
906655388 1:47544594-47544616 ATAGACAAACAGCTTCTTAAGGG - Intergenic
907586535 1:55622927-55622949 AAAGACAAACAGCTCAATGAGGG - Intergenic
910742149 1:90531343-90531365 ATAGACAAAAAGCTCTAAGATGG + Intergenic
911255059 1:95623551-95623573 ATATACAAAGATGTCCAACATGG - Intergenic
915920514 1:159972649-159972671 AGAGGGAAACAGCTCCACCATGG + Intergenic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
924898363 1:248367834-248367856 GTAAACAAACAGCTCCATGATGG + Intergenic
1067461184 10:46459901-46459923 TAAGACAAACAGCTCCAGGAGGG + Intergenic
1067626011 10:47924700-47924722 TAAGACAAACAGCTCCAGGAAGG - Intergenic
1067988693 10:51183266-51183288 ATAGATAAACAGCGCAAAAAGGG + Intronic
1069304092 10:66946977-66946999 GTACACAACCAGCTCCAAGAAGG + Intronic
1072492579 10:95922055-95922077 ATAGACAAGCATCTCCAAAAAGG + Exonic
1073006463 10:100329239-100329261 ATATACCAACAGCTCCCTCAGGG + Exonic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1076939887 10:133597008-133597030 ATAGAGAAACAGCTAGAATATGG - Intergenic
1078682455 11:13489886-13489908 ATAAACAAACAAAACCAACAAGG + Intergenic
1079233325 11:18668820-18668842 ACAGACAAACAGCTTATACATGG + Intergenic
1080937738 11:36881685-36881707 GTAGACCAACTGCTCCCACAGGG + Intergenic
1081474542 11:43413599-43413621 ATAGACAGAGAGCTCCTTCAAGG + Intronic
1083427380 11:62595417-62595439 TTACACAACCAGCGCCAACAGGG - Exonic
1086490149 11:87351236-87351258 ATAAAGAAACAGCTCAAAAAGGG - Intergenic
1087758130 11:102075962-102075984 ATTGACAAAGGGCTCCACCAAGG - Exonic
1088778586 11:113111104-113111126 ATGGACAATCAGCTACAGCAAGG - Intronic
1088794270 11:113254384-113254406 ATAGATTAAAAGCTGCAACAAGG - Intronic
1089143982 11:116311050-116311072 AAATCCAAACAGCCCCAACAGGG + Intergenic
1089519469 11:119054338-119054360 AAAACTAAACAGCTCCAACAGGG + Intronic
1090488386 11:127135582-127135604 ATAAGCAAATAGCTCCTACAGGG + Intergenic
1092641109 12:10510794-10510816 ATAAACAAACTGCACCAATATGG + Intronic
1092677972 12:10943227-10943249 AAAAACAATCAGCTCCATCATGG - Intronic
1093857271 12:24121015-24121037 AGAGAAAAACAGCACCAACTAGG + Intergenic
1099896262 12:88651186-88651208 ATAGACAACCACCTAAAACAGGG - Intergenic
1101208799 12:102515241-102515263 ATAGACCACAAGCCCCAACAGGG - Intergenic
1101827163 12:108229398-108229420 AAAGTCAAACAGCTCTGACATGG + Intronic
1102246471 12:111359639-111359661 AGAGAAAAACAGCTCCAAGAGGG - Intergenic
1102833199 12:116026953-116026975 ATACGGAAACACCTCCAACAAGG + Intronic
1103000786 12:117383921-117383943 AAATAGAAACAGCTCCAGCACGG - Intronic
1103276266 12:119714028-119714050 ATAAACTCACAGCTTCAACAGGG + Intronic
1105975652 13:25469772-25469794 ATAGTCATACAGCTCCTAAATGG + Intronic
1106570262 13:30920764-30920786 CTAGATAATCAGCTCCCACAAGG - Intronic
1107031494 13:35858450-35858472 AAAGACAAACAGCTGGAAGATGG + Intronic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1108257245 13:48622618-48622640 GTATACAGACAGCTCCAGCAGGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111195240 13:84867761-84867783 CTAGACAAACAGGTCCTACATGG + Intergenic
1112682069 13:101778177-101778199 ATAGGCAGACAGTTCCAACTGGG - Intronic
1112813498 13:103246668-103246690 ACAGACACACAGCAGCAACAGGG + Intergenic
1113756561 13:112815848-112815870 ACAGACAAACACCTGTAACAAGG - Intronic
1116610598 14:47066484-47066506 ATGAACAAACAGCATCAACATGG + Intronic
1116747065 14:48833768-48833790 ATATACAGACAGCTCTGACAGGG - Intergenic
1117779320 14:59216101-59216123 AGAGAAAATCAGCTCAAACAGGG - Intronic
1120145725 14:80976366-80976388 ACAGACCAACCGCTGCAACAGGG - Intronic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1121709664 14:96028084-96028106 ACAGACAAAGTGCTCCAGCAAGG - Intergenic
1123098974 14:105782972-105782994 ATAGACTCACAGCTACAACCTGG - Intergenic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1132080854 15:98864261-98864283 ATAGGCAAACATTACCAACATGG + Intronic
1132721358 16:1317775-1317797 ATAGAGAAACAGCTTCCAGATGG + Intronic
1134782388 16:16909995-16910017 ATATACAAATAGGGCCAACAGGG - Intergenic
1135289806 16:21225526-21225548 ATTGACTCACAGTTCCAACATGG - Intergenic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1140892662 16:79298478-79298500 CTTGACAACCAGCTCCAACTGGG + Intergenic
1148651113 17:49250659-49250681 ATAAACAAAAAGCTCCAGCCTGG + Intergenic
1156829552 18:41474462-41474484 AGAGACAAACAGGTAAAACAAGG + Intergenic
1156922505 18:42539958-42539980 ATGGACAAAAAGCTTGAACAGGG + Intergenic
1157458334 18:47858874-47858896 ATAGACAAACAATTGCAAAATGG + Intronic
1158773592 18:60551712-60551734 ATAGACAAAGAACTCACACAGGG + Intergenic
1159726913 18:71972156-71972178 ATACACAATCACCTCCCACAAGG + Intergenic
1161896014 19:7080978-7081000 TTAGACAGACAGCTCCATGAGGG - Intronic
1164155126 19:22590375-22590397 ATATACAAACAGCACAACCAAGG - Intergenic
1165290516 19:34880613-34880635 ATGGACTCACAGTTCCAACATGG - Intergenic
1166446151 19:42858488-42858510 ATAAAACAACAGCTCCAGCAGGG - Intronic
1167269968 19:48501109-48501131 AAACTCAAACAGCTCCCACAGGG + Exonic
1167941851 19:52953837-52953859 AGAGACCAACCTCTCCAACATGG + Intronic
927171746 2:20376023-20376045 ATAAACAAATAGGTCCAAAAGGG + Intergenic
928114572 2:28537929-28537951 AAAGAAAATCAGGTCCAACAGGG - Intronic
928241965 2:29594395-29594417 ATAGACAAACAGTACAAATAAGG + Intronic
934576685 2:95406164-95406186 ATAGACTCCCAGCTCCTACAAGG + Intronic
934638907 2:96014332-96014354 ATAGACTCCCAGCTCCTACAAGG + Intergenic
934794744 2:97091079-97091101 ATAGACTCCCAGCTCCTACAAGG - Intronic
936468739 2:112777901-112777923 ATAGGCAGACACCTCTAACAAGG - Intronic
937004919 2:118502519-118502541 TTAGACATACAGCTTCAAAAAGG + Intergenic
941804841 2:169701452-169701474 GTAGATAAACAGTTACAACAGGG + Exonic
945867429 2:215191807-215191829 ATAGTTAAGCAGCTCCAAAATGG + Intergenic
1169072176 20:2739315-2739337 AGGGACTAACAGCTCCACCACGG - Intronic
1173048664 20:39537633-39537655 ATAAATAAACATCTTCAACATGG + Intergenic
1175052064 20:56165000-56165022 AAAGACACACAGCTGCTACATGG - Intergenic
1176212604 20:63932346-63932368 ACAGACAAATAACCCCAACACGG - Exonic
1178119578 21:29454885-29454907 ATAGACGAACAGGTCAAACTTGG + Intronic
1179130884 21:38636221-38636243 ATTGACTCACAGTTCCAACATGG - Intronic
1179359963 21:40696470-40696492 AATGACAGACAGCTACAACAGGG - Intronic
1180198813 21:46212851-46212873 AGAGACCAACAGCACCCACAGGG + Intronic
1180709329 22:17829089-17829111 AGAGACCAGCAACTCCAACAAGG - Intronic
1182552901 22:31110830-31110852 ATAAACAAACAGCGCAAACAGGG - Intronic
949708399 3:6845397-6845419 AAAGACAAACAGGTACAACAAGG + Intronic
951343638 3:21519661-21519683 ATTTACAAAAAGCTCCAAAAAGG - Intronic
953666852 3:44931533-44931555 ATGGCCCAACAGCTCCACCAGGG + Intronic
955659799 3:61285966-61285988 ATATAGAAATAGCTCCAAGATGG + Intergenic
957360905 3:79156191-79156213 AAGGACAAACAGTTCCAAGAGGG - Intronic
957848181 3:85766962-85766984 ATAGATTAGCAGCTCCCACAGGG + Intronic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
963510181 3:146237109-146237131 AAAGACAAACAGGTCGAAAAAGG + Intronic
964328400 3:155573618-155573640 ATAGTCCCACAGTTCCAACAGGG + Intronic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
968406133 4:340712-340734 AAAGACAAACAGTTCAAAGAGGG - Intronic
968861565 4:3175596-3175618 AGAGCCACACAGCTCCCACATGG - Intronic
972361089 4:38326038-38326060 ATAGACACACAGGTTCAAAAAGG + Intergenic
973666177 4:53161924-53161946 ATAGACAAACAGGCCTAACCTGG - Intronic
976387085 4:84473284-84473306 AGAGAAAAACAGCACCAAAAAGG + Intergenic
977569835 4:98617652-98617674 ATAGGCCAACAGCTCCAAAGTGG + Intronic
977911164 4:102538619-102538641 ATAAACAAACAGCCTGAACATGG - Intronic
979114810 4:116810023-116810045 ATAGATAAAGAAGTCCAACATGG + Intergenic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979575977 4:122293348-122293370 CTAGGCAGACAGCTCCACCACGG + Intronic
981527959 4:145725616-145725638 ATACTAAAACAGCTACAACATGG + Intronic
984171988 4:176369948-176369970 ATAGAGAAACAGCTCTATCATGG + Intergenic
984445459 4:179830493-179830515 ATTTACCAAAAGCTCCAACAGGG - Intergenic
987671265 5:21012846-21012868 TCAGAAAAACAGCTCCGACATGG - Intergenic
988630489 5:32925763-32925785 ATAAACAAGCAGCTCCCACTTGG - Intergenic
989921419 5:49809271-49809293 ATCGAAAAACAGTTTCAACACGG - Intergenic
989925601 5:49870933-49870955 ATCGAAAAACAGTTTCAACACGG - Intergenic
989927543 5:49899720-49899742 ATCGAAAAACAGTTTCAACACGG - Intergenic
990153276 5:52845126-52845148 ATAAATAAACAGCCCCAAAAAGG + Intronic
995588618 5:113674849-113674871 ATGGAAAAACAGCCCCAACTGGG - Intergenic
995830717 5:116352162-116352184 AGAGACAAACTGCTCAAGCAAGG + Intronic
998707307 5:144778003-144778025 ATATAGAAACAGCTCCTATATGG - Intergenic
999235335 5:150087481-150087503 ATAGTCAAACAGCTACCAAATGG + Intronic
1000478177 5:161738254-161738276 AAAGACAAAGAGCTCCGAAAGGG + Intergenic
1001614172 5:173029095-173029117 ATAGAAAAACAGCTCCCACAGGG - Intronic
1002760574 6:198697-198719 ATAGAAAAATAGATGCAACAGGG + Intergenic
1003387734 6:5684578-5684600 ATAAACAAAAAGCTGCAACAAGG + Intronic
1005261947 6:24070511-24070533 ATACACAAATAGCTCAGACAAGG - Intergenic
1008958995 6:57246674-57246696 ATAACCAACCAGCTCGAACAGGG + Intergenic
1009498039 6:64374521-64374543 CTAGGAAAACATCTCCAACATGG - Intronic
1010198093 6:73259817-73259839 AAAGACAAAGAGCTTGAACATGG - Intronic
1013203272 6:107922621-107922643 ATAGACAAGCAGCTGAAACCAGG - Intronic
1015536672 6:134273723-134273745 ATAGAAAACAAGCTCCAAAAAGG + Intronic
1015886046 6:137919851-137919873 AAAGACTAACAGCCCCAGCAAGG + Intergenic
1016518125 6:144919670-144919692 GAAGACAAACAGCTCCATGAAGG + Intergenic
1021468776 7:20977686-20977708 AAAGACAAACAGAACCAACATGG - Intergenic
1027771095 7:82407097-82407119 ATAGACAAAGAGTTGCAGCACGG + Intronic
1028310818 7:89333406-89333428 ATAGAAAAGCAACTCCAGCAAGG + Exonic
1030176194 7:106657776-106657798 ATGGACAATCAGATCCAAAATGG + Exonic
1030724067 7:112904109-112904131 ACAGACAAACACCAACAACAGGG + Intronic
1031582664 7:123496088-123496110 ATGGAGAAACACCTCCAAGAAGG + Intronic
1033728545 7:144147874-144147896 ATAGACAAACAGATACAATTAGG + Intergenic
1034644687 7:152634463-152634485 ATAGACAGACAGAACCACCAAGG - Intergenic
1040559103 8:48508161-48508183 AAAAACAAACAGGTCCATCAGGG - Intergenic
1040562253 8:48533350-48533372 ATAGACAGACAGCTGCAAAAAGG + Intergenic
1041159109 8:55018944-55018966 ATAGACCAAAAACACCAACATGG + Intergenic
1041639709 8:60183872-60183894 CTTCACAAACAACTCCAACATGG - Intergenic
1046720060 8:117609148-117609170 ATAGACACATAGCAACAACAAGG - Intergenic
1046756298 8:117976127-117976149 ATAGAGAAATAGCTCTAATATGG - Intronic
1047710890 8:127551256-127551278 ATAGACACAGAGATTCAACAGGG - Intergenic
1048708206 8:137178375-137178397 ATAGACAGACAGCTGCACAATGG - Intergenic
1050093585 9:2040703-2040725 ATAGACTAACAGATTCAACATGG + Intronic
1055417758 9:76102236-76102258 AAGGACAAACAGCTACAAAAGGG - Intronic
1057998813 9:99844812-99844834 GAGGACAAACAGCTCCAAAAAGG - Exonic
1058475435 9:105328200-105328222 GTAGAATATCAGCTCCAACAGGG - Intronic
1059000722 9:110345723-110345745 ATACACAAACAGATCGCACATGG + Intergenic
1185863633 X:3603195-3603217 AAAGTCAGAGAGCTCCAACAGGG + Intergenic
1186210377 X:7244294-7244316 ATAGGCAACCATCTCCAAAAAGG - Intronic
1187673427 X:21691462-21691484 AGAGACAAATATCTCCAACTAGG + Intergenic
1187984495 X:24795780-24795802 AAAGACAAACACCTCTATCATGG - Intronic
1188670882 X:32880260-32880282 ATAGGCTGAAAGCTCCAACAGGG + Intronic
1192433882 X:71130351-71130373 CGAGAGAAACAGCTCCAGCATGG + Intronic
1192496834 X:71621852-71621874 AAAGTCACACAGCTCGAACAGGG - Intergenic
1196825955 X:119740397-119740419 ATTGACAAATAGCACCAACCTGG + Intergenic
1197951481 X:131902168-131902190 ATAGACAGATGTCTCCAACAGGG - Intergenic
1199462397 X:148099089-148099111 ATAGACTACCAGCTCCATGAGGG + Intergenic
1201583677 Y:15537131-15537153 ATAGGCAACCATCTCCAAAAAGG - Intergenic