ID: 1107290966

View in Genome Browser
Species Human (GRCh38)
Location 13:38852746-38852768
Sequence TACGCCACTGCATGCTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79118
Summary {0: 1, 1: 19, 2: 364, 3: 7041, 4: 71693}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107290966_1107290967 9 Left 1107290966 13:38852746-38852768 CCAGGCTAGCATGCAGTGGCGTA 0: 1
1: 19
2: 364
3: 7041
4: 71693
Right 1107290967 13:38852778-38852800 CACTGCAGTCTCCGTGTCTTAGG 0: 1
1: 0
2: 33
3: 692
4: 9330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107290966 Original CRISPR TACGCCACTGCATGCTAGCC TGG (reversed) Intronic