ID: 1107290967

View in Genome Browser
Species Human (GRCh38)
Location 13:38852778-38852800
Sequence CACTGCAGTCTCCGTGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10056
Summary {0: 1, 1: 0, 2: 33, 3: 692, 4: 9330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107290966_1107290967 9 Left 1107290966 13:38852746-38852768 CCAGGCTAGCATGCAGTGGCGTA 0: 1
1: 19
2: 364
3: 7041
4: 71693
Right 1107290967 13:38852778-38852800 CACTGCAGTCTCCGTGTCTTAGG 0: 1
1: 0
2: 33
3: 692
4: 9330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107290967 Original CRISPR CACTGCAGTCTCCGTGTCTT AGG Intronic
Too many off-targets to display for this crispr