ID: 1107291912

View in Genome Browser
Species Human (GRCh38)
Location 13:38864152-38864174
Sequence TGCCATACAGCAGTGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107291912 Original CRISPR TGCCATACAGCAGTGGTGTA TGG (reversed) Intronic
902796894 1:18806047-18806069 TTCCATACAGCAGGTGTGAAAGG + Intergenic
905443413 1:38008930-38008952 TGCCTCACAGCATTGTTGTAAGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908411078 1:63866126-63866148 TGCCAAACAGCACTGGTGCTGGG - Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
913145450 1:115985325-115985347 TGCCATATAGCCTAGGTGTATGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918347652 1:183619669-183619691 TGCCACACAGTTGTGCTGTAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921370666 1:214419619-214419641 TGCCAGACAGCATTGGTTTCTGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1063421701 10:5917322-5917344 TCCCATACAGCAGTGGAGCCAGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068047650 10:51908360-51908382 TGTCATACAGGAATAGTGTATGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071077920 10:81776664-81776686 TGCCATTGAGCAGTGGCCTAAGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072760081 10:98049350-98049372 TGCCATGGGGCAGTGGTGCACGG + Intergenic
1075310324 10:121408260-121408282 TGCAATACAGCAGGGATGGATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077236699 11:1485322-1485344 TGCCTGACATCAGTGGTGTGAGG - Intronic
1078417829 11:11180345-11180367 AGCCATCCAGCAGGTGTGTAGGG + Intergenic
1079574329 11:21984691-21984713 TGACACACAGCAGTGGTGTCTGG + Intergenic
1079621974 11:22566655-22566677 TACCCTACAGTAGTGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079700249 11:23537303-23537325 TGCCAAACAGTAGTGGTCCATGG + Intergenic
1079956708 11:26875372-26875394 TGCCATACAGCTGTGGTCCCAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085403591 11:76248660-76248682 TGCTACACAGCAGTGGCATATGG + Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087889136 11:103517016-103517038 TACCATACAGCCTAGGTGTATGG - Intergenic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1090736090 11:129613300-129613322 AGCCACAGAGCAGTGGAGTAGGG + Intergenic
1091216101 11:133903090-133903112 AGCCATACAGAAGTGGGGAAAGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093734035 12:22598886-22598908 TACCATACAGCCTAGGTGTATGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1102479419 12:113211083-113211105 TGCCATACTGCAGTGGACAATGG + Intronic
1102660093 12:114518881-114518903 TGCCTTACAGCAGAGTTATATGG + Intergenic
1103401016 12:120642521-120642543 GGCCATAGGGCAGTGGTGTGTGG + Intronic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106336058 13:28784209-28784231 TGCCATACCCCAGTGGTGCCTGG - Intergenic
1107291911 13:38864150-38864172 TGCCATACACCACTGCTGTATGG + Intronic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108448676 13:50536859-50536881 TGTCATACAGCTTTGGTGTGGGG + Intronic
1108747122 13:53407254-53407276 TGCCATACGGCCTAGGTGTATGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110380944 13:74850018-74850040 TACTATACAGCTGTGGTGAAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110709714 13:78636877-78636899 AGCCATACAGTAGTGGTGGGGGG - Intronic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116114203 14:40627444-40627466 TGCTATACTCCAGTGGTGTAAGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118227855 14:63919739-63919761 TGCCACACAGCAGTCAAGTAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119746340 14:77047072-77047094 TGCCTTAAAGCAATGTTGTAAGG - Intergenic
1120341435 14:83225694-83225716 TGTCATTCAGCAGTGGTCGACGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128431057 15:67593988-67594010 TGCCTTAAAACAGTGCTGTATGG + Intronic
1128431058 15:67593990-67594012 TACCATACAGCACTGTTTTAAGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1135808492 16:25566115-25566137 TGCCATACAGCAGGGGCTTGGGG - Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1137547291 16:49413172-49413194 TGCCCTACAGCAGTGGCAAAAGG - Intergenic
1137675718 16:50302914-50302936 GGCCACACAGCAATGGCGTAAGG - Intronic
1139359311 16:66387753-66387775 GGCCATGCAGGAGTGGTGTGGGG + Intronic
1143327310 17:6107878-6107900 TTCCATAGAAGAGTGGTGTAGGG + Intronic
1144378005 17:14664897-14664919 AGCCTTACAACAGTGCTGTATGG + Intergenic
1144378006 17:14664899-14664921 TACCATACAGCACTGTTGTAAGG - Intergenic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155745442 18:29351357-29351379 TGCCATGCAGCAGTGGTTAAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1159042919 18:63342383-63342405 TGCCACCCAGCGGTGGTGTCAGG - Intronic
1165366051 19:35365760-35365782 TGCCATGTAACAGGGGTGTAGGG + Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1166671279 19:44710854-44710876 TGGCATCCAGCAGTGGGGTGTGG - Intergenic
1166987457 19:46669881-46669903 TGGCAGACAGGAGTGTTGTAGGG + Intergenic
1167580820 19:50341287-50341309 TCACCTACAGCAGTGGTGTTGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925415024 2:3663825-3663847 TGCCAGACAGCACAGGTGTGTGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932115452 2:69042711-69042733 GGCCAGACAGCAGTGGGTTAAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933958340 2:87390069-87390091 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934242466 2:90281986-90282008 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934270709 2:91534697-91534719 TGAGAAACAGCAGAGGTGTACGG + Intergenic
935147723 2:100407532-100407554 TGCCATGCAGAAGTGATGGATGG - Intronic
935182528 2:100703767-100703789 TGCCTTCCTGCAGTGGTGTCAGG - Intergenic
936165235 2:110115071-110115093 TGCCATAAAACAGTCGTGTGCGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939246339 2:139628310-139628332 TGTCATAAAGCTGTTGTGTAGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940769788 2:157827815-157827837 TGTCACACAGCAGTGGTGCGGGG - Intronic
942551867 2:177128074-177128096 TAATATACAGCAGTGGTGTCAGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
947266736 2:228290601-228290623 TGCCATAAAGCAGTGGAGTAAGG + Intergenic
1169013987 20:2276273-2276295 TGCCATACAGCTGGGCTGTCAGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172103529 20:32500767-32500789 TGCCATACCTCATTGGTGTTTGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1175031262 20:55956600-55956622 TACCATACAGCATTGATGAAAGG + Intergenic
1175607799 20:60325227-60325249 TTCCATTCAGCTGTGGTTTATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178007074 21:28234153-28234175 TTTCATACCCCAGTGGTGTATGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179481158 21:41679494-41679516 TGCCAGACAGCCGGGATGTAAGG + Intergenic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1181923292 22:26337653-26337675 TTCAATACAGCAGGGGTTTAGGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182939240 22:34258985-34259007 TGCCAAACAGCGTTTGTGTAGGG + Intergenic
1183473595 22:38023181-38023203 TCCCAGACAGCAGTGGGGTCTGG + Intronic
950538921 3:13598464-13598486 TGCTACATAGAAGTGGTGTAAGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
952208466 3:31204370-31204392 TGCCATAGTAAAGTGGTGTATGG - Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
954056418 3:48029542-48029564 TTCCATAAAGCAGAGGTGTCAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955795648 3:62633727-62633749 TGCTTCACAGCAGTGGTGCAGGG + Intronic
955908122 3:63829302-63829324 CACCATACAGCAGTGGGGTAAGG + Intronic
957034656 3:75282634-75282656 TGCAATACAGCAATGGTGGGAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962124677 3:132603838-132603860 TGCAATAAAGCAGTTGTCTAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963271745 3:143291946-143291968 TGGCTTAGAGCAGAGGTGTAGGG - Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
969120372 4:4904291-4904313 TGGCAGACAGCAGTGGACTATGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969834751 4:9831534-9831556 TTACAGACAACAGTGGTGTAGGG - Intronic
971252801 4:24987184-24987206 TGTGATATGGCAGTGGTGTAAGG + Intergenic
971767648 4:30853936-30853958 TGCCACACAGCAGGGCTGCATGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974627445 4:64443017-64443039 TCCCATACATCCCTGGTGTATGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975844566 4:78511403-78511425 TGCCACACACCAGTGGTGGCTGG + Intronic
977081482 4:92534723-92534745 TGGCATTCACCAGTGATGTAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
987404633 5:17512303-17512325 TACCAGACAGCAATGGTGTTGGG + Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991677793 5:69105947-69105969 TTCCAGACAGCAGTGGTGGGGGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992932635 5:81665343-81665365 TGCCACACAGCACTGATGGATGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994684065 5:102927140-102927162 TGCCTTACAGCAGTGGACAATGG - Intronic
995105420 5:108372024-108372046 TGCCATACAGAAGGGGAGGAGGG - Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995142868 5:108752611-108752633 AGCCATACAGCAGTTTTATATGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
999477333 5:151912605-151912627 TGAGATACAGCAGTGCTTTAGGG + Intronic
1000277077 5:159747540-159747562 AGCCAGACAGCAGTTTTGTAAGG - Intergenic
1003360999 6:5425137-5425159 TGCCAAACACCAGTGGTTAATGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1011343946 6:86348193-86348215 TGCTGTAGAGCAGTTGTGTAAGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014836585 6:126167144-126167166 TTTCATACCCCAGTGGTGTATGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018462870 6:164015704-164015726 GGCCATACAGCAGGGCTGTCTGG - Intergenic
1020178536 7:5902929-5902951 TTCCCTCCAGCTGTGGTGTAAGG + Intronic
1020304389 7:6822074-6822096 TTCCCTCCAGCTGTGGTGTAAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022957946 7:35398649-35398671 TGCCAGACACCAGTGATGTCTGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1025246137 7:57318966-57318988 TGCCATAAGGCAGCAGTGTATGG + Intergenic
1025280373 7:57622622-57622644 TGCCATAGAGCCTAGGTGTACGG + Intergenic
1025304360 7:57842879-57842901 TGCCATAGAGCCTAGGTGTACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029528432 7:101109473-101109495 TGGCATAGAGCAGAGGGGTATGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031603006 7:123735798-123735820 TGCTATACAGCAGTGAGGTATGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1048449563 8:134521888-134521910 TTCCAGACAGCTGTGGTGTTGGG - Intronic
1051516079 9:17931877-17931899 TGCCAATCAGCACTGCTGTAAGG - Intergenic
1052733797 9:32319477-32319499 TGCCCTTCAGCAGTGATGAATGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1058175947 9:101737405-101737427 TGCCATACCGTGGTGGTGCAAGG - Exonic
1058439992 9:104997876-104997898 TACCTTACAGCATTGGTGTAGGG + Intergenic
1062167443 9:135114966-135114988 TGCCATAGAGCAGGGGTGGGTGG - Intronic
1191132657 X:57031050-57031072 TTCCATACTGCAGTGGTGTCTGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191189214 X:57648747-57648769 TGGCTTACAGCAGTTGTTTATGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193184418 X:78495446-78495468 TGGCATACAGCAATTGTCTAGGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200126917 X:153819537-153819559 TACTCTACAGCAGTGGGGTAAGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1202335152 Y:23801116-23801138 TTCCATACCGCAGTGGTGCCTGG + Intergenic
1202535615 Y:25868943-25868965 TTCCATACCGCAGTGGTGCCTGG - Intergenic