ID: 1107292040

View in Genome Browser
Species Human (GRCh38)
Location 13:38865775-38865797
Sequence CAGTATAAGATGGTGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107292037_1107292040 1 Left 1107292037 13:38865751-38865773 CCAATAGAAATAGCAATAGAGAA 0: 1
1: 1
2: 2
3: 23
4: 373
Right 1107292040 13:38865775-38865797 CAGTATAAGATGGTGGAATCTGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107292040 Original CRISPR CAGTATAAGATGGTGGAATC TGG Intronic
903662210 1:24985036-24985058 CAGAATAACATGGGGGGATCGGG - Intergenic
903828539 1:26161532-26161554 CGGTAGAAGATGAGGGAATCAGG - Exonic
904396003 1:30222743-30222765 CAGGGTAAGATGGTGGAGTAGGG - Intergenic
905935213 1:41817954-41817976 CAGCTCAAGAGGGTGGAATCAGG - Intronic
910345331 1:86229878-86229900 CAGCATAAGATGGTTGAAACAGG + Intergenic
912720043 1:112012398-112012420 CAGTATAAAAGGGTGTAATATGG - Intergenic
916337617 1:163691261-163691283 CAGTATAAGATAGAGAAAGCAGG - Intergenic
920593098 1:207241543-207241565 CAGGGCAAGAGGGTGGAATCAGG - Intergenic
1063055309 10:2497726-2497748 AAGTAGAAGATGATGGAAACAGG + Intergenic
1066018843 10:31276365-31276387 CAGGATAAGAAGGCGGAAGCAGG + Intergenic
1068719120 10:60222707-60222729 CAGTATAAGTTAAGGGAATCAGG - Intronic
1077909961 11:6564919-6564941 TAGTATAGGCTGGTGAAATCTGG - Intronic
1078897708 11:15612193-15612215 CAGTAAAGGATGCTGCAATCTGG + Intergenic
1078961377 11:16276615-16276637 CATTATAAGATGGTCGCAGCAGG - Intronic
1081095017 11:38921511-38921533 CAGTAAGAGATGGTGTATTCTGG - Intergenic
1082889301 11:58121557-58121579 CAGTGTAGGATAATGGAATCTGG - Intronic
1086778754 11:90875745-90875767 CAGTATAAGATAATAGAATCTGG - Intergenic
1091183034 11:133624595-133624617 CAGAAAAAGATGGTGGAGTCTGG - Intergenic
1093412572 12:18884181-18884203 CAGTATAAACTGGTAAAATCTGG - Intergenic
1095618986 12:44226692-44226714 CCGTATAAGAAGGTGAAATTAGG + Intronic
1101104740 12:101428736-101428758 CAGTCAAACATTGTGGAATCGGG + Intergenic
1105666453 13:22563203-22563225 CATTATATGAAGGTGGAATGTGG + Intergenic
1107292040 13:38865775-38865797 CAGTATAAGATGGTGGAATCTGG + Intronic
1108360155 13:49661826-49661848 CATTACAAGATGGTGGAAAATGG + Intronic
1112035966 13:95496862-95496884 CAGTAGCAGATGGTGCAATGAGG - Intronic
1112682592 13:101784126-101784148 CAGGATAAGTTAGAGGAATCAGG - Intronic
1114979682 14:28147423-28147445 CAGTATAGGAGGATGGAAGCAGG - Intergenic
1116220681 14:42083416-42083438 CAGTATAAAATGTTAGAATTAGG + Intergenic
1118060691 14:62135053-62135075 CAGGTGAAGATGATGGAATCGGG - Intergenic
1118640619 14:67788855-67788877 CAGTATATGAAGGTAGAATTAGG - Intronic
1119011847 14:71000885-71000907 CAGTACAATATAGTGGACTCTGG + Intronic
1125275765 15:37989780-37989802 CATTCTAACATGGTGGAATAGGG + Intergenic
1129112569 15:73346196-73346218 CAGTATAATATGGTGGGAGGAGG + Intronic
1132135582 15:99335265-99335287 CACTGTGAAATGGTGGAATCAGG - Intronic
1139325550 16:66150148-66150170 CAGTTTAAGATGGGGGACTCAGG - Intergenic
1145048311 17:19637196-19637218 AAGTTTAAGATGGTGCAATTAGG + Intergenic
1149353111 17:55811936-55811958 CAGTAAATAATGGTTGAATCAGG - Intronic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1152157261 17:78642539-78642561 CAGTTAAAGATGGTGGAGCCAGG + Intergenic
1155434054 18:25792708-25792730 CTTTATCAGATGGTGGAATGGGG - Intergenic
1155564955 18:27123818-27123840 CAGTATAAGATGGAGGTCCCAGG - Intronic
1156927450 18:42598686-42598708 AAGTACAAGATGGAGGCATCAGG - Intergenic
1159020004 18:63135653-63135675 CAATGGGAGATGGTGGAATCAGG - Intronic
1159701019 18:71627306-71627328 GGGAATAAGGTGGTGGAATCTGG - Intergenic
1165944787 19:39435593-39435615 CAGTACAAGGTGCTGGGATCCGG - Exonic
929072218 2:38043778-38043800 AAGGATAAGAAGGAGGAATCTGG - Intronic
929613295 2:43287943-43287965 AAGGACAAGATGGTGGAAGCTGG + Intronic
931375107 2:61700015-61700037 CAGTATAAATTGGAGCAATCTGG - Intergenic
932959130 2:76391375-76391397 CAGTAAAAGATGTTGGTAACAGG - Intergenic
934745084 2:96754048-96754070 CACGATAAGATTGAGGAATCAGG + Intergenic
941299161 2:163779699-163779721 CAGTATACGGTGATGAAATCAGG - Intergenic
942798307 2:179847304-179847326 GAGAATAAGCTGGTAGAATCTGG - Intronic
943469820 2:188280172-188280194 AAGTATATGATGTAGGAATCCGG - Intergenic
944323012 2:198370262-198370284 AAGTATAAGATGGTGTTATAAGG + Intronic
947372685 2:229464759-229464781 CTGTGTAAGATAGTGGAGTCAGG + Intronic
948317593 2:237040684-237040706 AAGTATATGATGTTGGGATCTGG + Intergenic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1168840677 20:908109-908131 CAGACAAAGATGGTGGAAGCTGG + Intronic
1172425785 20:34854992-34855014 CAGTGTGTGATGGTGGAATGTGG - Intronic
1177820175 21:26022777-26022799 CAGTATATGCTGGTGGAAATTGG + Intronic
1181887295 22:26031485-26031507 CAATATAAAATGGGGAAATCTGG - Intergenic
1184295890 22:43524997-43525019 CAGTATAAGATGGTCTAATATGG - Intergenic
954120251 3:48494136-48494158 CAGAATAAAATGGTGGTAACCGG - Intronic
955089576 3:55736161-55736183 CACAATAGAATGGTGGAATCTGG - Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955631537 3:60980636-60980658 CAGGAAAAGATGGGGGAATGGGG + Intronic
959128834 3:102325753-102325775 GAGTATAAGATAATAGAATCAGG + Intronic
959698500 3:109275219-109275241 CAGTATAAAATGATGGTTTCAGG - Intergenic
966506082 3:180703380-180703402 AAGTAAAAGATGGTGGAAAACGG + Intronic
970559337 4:17267648-17267670 TAGTTTAAAATGGTTGAATCTGG - Intergenic
979450642 4:120866688-120866710 TAGTATAACATGGTGGGCTCTGG - Intronic
980885996 4:138763215-138763237 CACTATTAAGTGGTGGAATCAGG - Intergenic
982125127 4:152177816-152177838 CAGTCTAAGATGGTGCAAAGGGG - Intergenic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
986186028 5:5439382-5439404 CAGTATGAGATGGTAAAATAAGG + Intronic
987663962 5:20911871-20911893 GAGTCTGAGATGGTGGAATAAGG + Intergenic
988098731 5:26651515-26651537 CAGTATATTATGGTGGAAAAAGG + Intergenic
988758728 5:34290320-34290342 GAGTCTGAGATGGTGGAATAAGG - Intergenic
989798160 5:45501202-45501224 AAGTATAATATGGTAGAATCAGG - Intronic
991194190 5:63912463-63912485 CAGTATAAGATGGTATAAAGGGG + Intergenic
992730715 5:79665441-79665463 CAGAAAAAAATGATGGAATCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
995857679 5:116610635-116610657 CAGCATGAGAAGGTGGCATCTGG + Intergenic
998509880 5:142702934-142702956 CAGTATGAAAGGGTGGAATTAGG - Intergenic
1000703765 5:164486075-164486097 CTGTAGAAGTTGGGGGAATCAGG - Intergenic
1016844708 6:148559090-148559112 CAGTTTCAGATGACGGAATCAGG - Intergenic
1017444962 6:154499343-154499365 CAGGATAAAATGGGAGAATCAGG - Intronic
1022211115 7:28210421-28210443 CAGTAGATGAGGGTGGAATTTGG + Intergenic
1024783841 7:52883494-52883516 CACTATAAGATGCTGTAAGCAGG + Intergenic
1035683000 8:1502451-1502473 CAATATAAGATGATGGAAATGGG + Intronic
1038050988 8:23811446-23811468 CAGTATAAAATGGTGGCCACAGG + Intergenic
1042257028 8:66815851-66815873 CAGTATAAGATTTTGGAAACTGG - Intronic
1044205004 8:89483503-89483525 CAGCAAAAGATGGTGCACTCAGG - Intergenic
1047477614 8:125249219-125249241 CAGTATAATAAAGTGGACTCTGG - Intronic
1047790600 8:128199789-128199811 CAGTAATAGATTTTGGAATCAGG + Intergenic
1050089021 9:1997608-1997630 CAATATGACATGGTGGAAACTGG - Intergenic
1050135688 9:2461368-2461390 CAGTGGAAGGTGGTGGAGTCAGG + Intergenic
1050933073 9:11355151-11355173 AAGCATCAGATGGTGTAATCTGG + Intergenic
1053184750 9:36006050-36006072 CATTCTATGTTGGTGGAATCTGG + Intergenic
1058757006 9:108092085-108092107 CAGTATAGGACTTTGGAATCTGG - Intergenic
1059289793 9:113212541-113212563 CAGTATAAAAAGGTGGTATGAGG - Intronic
1060280262 9:122211051-122211073 CAGTTTTAGATGTTGGAATATGG - Intronic
1060817767 9:126644369-126644391 CAGCAGAGGATGGTGGAGTCAGG + Intronic
1186527057 X:10258326-10258348 CAGTAGCAGTTGGTGGAGTCAGG + Intergenic
1188713144 X:33426962-33426984 CAGTATATGATAGTAGAACCAGG + Intergenic
1190549501 X:51564035-51564057 CAGTATAAAATGGACAAATCAGG + Intergenic
1192743907 X:73919845-73919867 CAGAACAAGAAGGTGGAATAAGG + Intergenic
1196787426 X:119433151-119433173 CAGTACACAATTGTGGAATCTGG + Intronic
1201596738 Y:15678894-15678916 CAGTATGAGATGTTGGAAAAGGG + Intergenic