ID: 1107297034

View in Genome Browser
Species Human (GRCh38)
Location 13:38920599-38920621
Sequence GAGTATTAGATCATCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107297034_1107297039 20 Left 1107297034 13:38920599-38920621 CCTGCCTCGATGATCTAATACTC No data
Right 1107297039 13:38920642-38920664 GTTCTCCACTATTTATTGTGTGG No data
1107297034_1107297038 -10 Left 1107297034 13:38920599-38920621 CCTGCCTCGATGATCTAATACTC No data
Right 1107297038 13:38920612-38920634 TCTAATACTCTCTGTTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107297034 Original CRISPR GAGTATTAGATCATCGAGGC AGG (reversed) Intergenic
No off target data available for this crispr