ID: 1107298952

View in Genome Browser
Species Human (GRCh38)
Location 13:38945801-38945823
Sequence CCTAGAATGTTCCAGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107298952_1107298958 18 Left 1107298952 13:38945801-38945823 CCTGGCCTCTGGAACATTCTAGG No data
Right 1107298958 13:38945842-38945864 CACATGCACATGCCTCTCCCTGG No data
1107298952_1107298959 19 Left 1107298952 13:38945801-38945823 CCTGGCCTCTGGAACATTCTAGG No data
Right 1107298959 13:38945843-38945865 ACATGCACATGCCTCTCCCTGGG No data
1107298952_1107298956 -8 Left 1107298952 13:38945801-38945823 CCTGGCCTCTGGAACATTCTAGG No data
Right 1107298956 13:38945816-38945838 ATTCTAGGAGGACAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107298952 Original CRISPR CCTAGAATGTTCCAGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr