ID: 1107298956

View in Genome Browser
Species Human (GRCh38)
Location 13:38945816-38945838
Sequence ATTCTAGGAGGACAGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107298952_1107298956 -8 Left 1107298952 13:38945801-38945823 CCTGGCCTCTGGAACATTCTAGG No data
Right 1107298956 13:38945816-38945838 ATTCTAGGAGGACAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107298956 Original CRISPR ATTCTAGGAGGACAGCACAC AGG Intergenic