ID: 1107298959

View in Genome Browser
Species Human (GRCh38)
Location 13:38945843-38945865
Sequence ACATGCACATGCCTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107298952_1107298959 19 Left 1107298952 13:38945801-38945823 CCTGGCCTCTGGAACATTCTAGG No data
Right 1107298959 13:38945843-38945865 ACATGCACATGCCTCTCCCTGGG No data
1107298955_1107298959 14 Left 1107298955 13:38945806-38945828 CCTCTGGAACATTCTAGGAGGAC No data
Right 1107298959 13:38945843-38945865 ACATGCACATGCCTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107298959 Original CRISPR ACATGCACATGCCTCTCCCT GGG Intergenic