ID: 1107300192

View in Genome Browser
Species Human (GRCh38)
Location 13:38958056-38958078
Sequence GCAGCCCAGCAGTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107300184_1107300192 22 Left 1107300184 13:38958011-38958033 CCATGGGAGGACTTCTGAGAGGG No data
Right 1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG No data
1107300189_1107300192 -8 Left 1107300189 13:38958041-38958063 CCCACGAGCACCAGCGCAGCCCA No data
Right 1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG No data
1107300190_1107300192 -9 Left 1107300190 13:38958042-38958064 CCACGAGCACCAGCGCAGCCCAG No data
Right 1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107300192 Original CRISPR GCAGCCCAGCAGTCACATCC TGG Intergenic
No off target data available for this crispr