ID: 1107306955

View in Genome Browser
Species Human (GRCh38)
Location 13:39032448-39032470
Sequence CCCTTTTGGAGCATCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107306955_1107306960 21 Left 1107306955 13:39032448-39032470 CCTCCAAAGATGCTCCAAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1107306960 13:39032492-39032514 CAGTTCCTGAAAATACGCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107306955 Original CRISPR CCCTTTTGGAGCATCTTTGG AGG (reversed) Intronic
902516311 1:16991633-16991655 CCTTTTTGGGGCATCTTTTTGGG - Intronic
904510931 1:31007040-31007062 TCCTTTTGGTCCATCTTTGCTGG + Exonic
905253378 1:36664551-36664573 TCATTTTGTAGCATCTCTGGTGG + Intergenic
909021223 1:70433486-70433508 CCCTCATGGAGCAACTCTGGTGG + Intronic
909321729 1:74297331-74297353 CCCCTTGGGATCATATTTGGTGG + Intronic
910441586 1:87258335-87258357 GCCTTTTGCAGCAACTTGGGTGG - Intergenic
911553562 1:99314644-99314666 GCCATTTGGAGAATATTTGGAGG - Intergenic
911953073 1:104201119-104201141 GCCTTTTGGAGAATCTCTGAGGG - Intergenic
911973988 1:104468103-104468125 GCCCTGTGGAGCATCTCTGGAGG - Intergenic
915980466 1:160416868-160416890 CCCCTTGGGATCATCTTTGGGGG + Intronic
916026076 1:160834709-160834731 TCCTTTTGGAGCCTCATTTGTGG - Intronic
917052437 1:170939393-170939415 CCCTTTTGGGACATCTCTGAAGG - Intronic
917592108 1:176487030-176487052 CCTTTTTTGAGGATCTGTGGAGG - Intronic
918129261 1:181610726-181610748 CCACATTGGAGCATCTTGGGTGG + Intronic
919646587 1:200100923-200100945 CCCTTATGGAGCTTATTTTGGGG + Intronic
923971925 1:239213370-239213392 CCCTTTAGGAAAATCTTTGGGGG - Intergenic
1064910368 10:20394797-20394819 CACTTTGGGAGCATCATTTGAGG + Intergenic
1066787129 10:39017155-39017177 TTCTTTTGGAGAATCTGTGGAGG - Intergenic
1066793641 10:39094390-39094412 CTCTTTTGGAGAATCTGTGAAGG + Intergenic
1066928640 10:41729175-41729197 TCCTTTTGGAGAATCTGTGAAGG + Intergenic
1066928971 10:41732918-41732940 TCTTTTTGGAGAATCTGTGGAGG + Intergenic
1066929468 10:41738910-41738932 TCTTTTTGGAGCATCTGTGAGGG + Intergenic
1066929617 10:41740625-41740647 TCCTTTTGGAGAATCTGTGAAGG + Intergenic
1070393794 10:75993953-75993975 TCCTGATGGAGCATCTTTGCAGG + Intronic
1072517763 10:96202639-96202661 TCCTTTTGGCCCATCTTTGTTGG - Intronic
1073379677 10:103068251-103068273 CCCTTTGGGAGCACTTTGGGAGG + Intronic
1074916630 10:117962891-117962913 CCCATTTGGGGCATCATTTGGGG + Intergenic
1075797387 10:125130371-125130393 CCCTTGCTGAGCCTCTTTGGAGG + Intronic
1079334869 11:19562380-19562402 AGCTTTTGGGGCATCTCTGGGGG + Intronic
1081000518 11:37664956-37664978 CCCTTTGGGAGCACTTTGGGAGG + Intergenic
1081194626 11:40146565-40146587 TCCTTATGCAGCATCCTTGGGGG - Intronic
1088848123 11:113684409-113684431 CCCTCTTGGAACATCTCAGGAGG + Intergenic
1089833667 11:121351052-121351074 CCCTTTTGTGGCATTTTTGTAGG - Intergenic
1092114637 12:5990943-5990965 CCCTTTTGCTGCATCTTTTTTGG - Intronic
1095585013 12:43839918-43839940 CACTTTTGGATAATCTTTGTTGG + Intronic
1095955711 12:47804635-47804657 CCCTTTTCTATCTTCTTTGGAGG + Intronic
1098154523 12:67583577-67583599 CTCTTCTGAAGCATGTTTGGGGG + Intergenic
1098379256 12:69851812-69851834 CCATCTTGGCTCATCTTTGGGGG + Intronic
1100796301 12:98185288-98185310 CCCTTTGGGGAGATCTTTGGTGG + Intergenic
1102951242 12:117033029-117033051 CCCTGTTGGAGCCCCTGTGGTGG - Intergenic
1104264492 12:127219125-127219147 CCTTTTAGGGGCATTTTTGGAGG - Intergenic
1107057585 13:36124028-36124050 CACTTGTGTAGCATCTATGGGGG - Intronic
1107306955 13:39032448-39032470 CCCTTTTGGAGCATCTTTGGAGG - Intronic
1107427469 13:40308215-40308237 CCCATATGGAGCCTCTTTGCAGG + Intergenic
1109804991 13:67427921-67427943 CACTTTTAGATCATCTTTTGAGG + Intergenic
1112011081 13:95294412-95294434 CCCTTTTGGGCCATCTAGGGTGG + Intronic
1114625034 14:24123375-24123397 CCCTTGTGGGGAATGTTTGGAGG + Exonic
1115802544 14:37011253-37011275 CCCTTTGGGAGGATCTCTTGAGG - Intronic
1117680797 14:58200565-58200587 CCCTTTGGGATCATCTGTGTAGG + Intronic
1118393606 14:65317100-65317122 CCATTATGGAGCTTCTTTGAGGG + Intergenic
1122349293 14:101078190-101078212 CCCTGTTGGAGCACCCTAGGGGG + Intergenic
1123766114 15:23479912-23479934 GCCTTTTAGACCATCTTTGAAGG - Intergenic
1126415347 15:48412479-48412501 ACACTTTGGAGCATCCTTGGAGG + Intronic
1126692958 15:51302056-51302078 CCCTTCTTGATCATTTTTGGGGG + Intronic
1128324771 15:66717190-66717212 CCCTTTGGGAGCATGGCTGGTGG + Intronic
1130043053 15:80421093-80421115 GCCTTTTGGAGCAACTTGGATGG + Intronic
1132369968 15:101289132-101289154 CCTTTTTGGATCATCTTCAGTGG - Intronic
1133220958 16:4318969-4318991 CTCTTGTGGGGCATCTTGGGGGG + Intronic
1133846054 16:9454821-9454843 TCCATTTGGAACATCTTTGAGGG + Intergenic
1135421342 16:22307612-22307634 CCCTTTTCCAGCATCTTGTGAGG + Intronic
1135786322 16:25352535-25352557 CCCTTTGGGAGCACTTTGGGAGG - Intergenic
1135915756 16:26604152-26604174 GCCTTTTGCAGCATCTCTTGTGG - Intergenic
1136742863 16:32554579-32554601 TTCTTTTGGAGCATCTGTGAAGG + Intergenic
1136745214 16:32581521-32581543 TCCTTTTGTAGAATCTGTGGAGG + Intergenic
1136923211 16:34348322-34348344 CCCTTTCTGAGTATTTTTGGGGG - Intergenic
1136981362 16:35063484-35063506 CCCTTTCTGAGTATTTTTGGGGG + Intergenic
1137059439 16:35775030-35775052 ACCTTTTGTAGCATCTATGAAGG - Intergenic
1139936630 16:70576317-70576339 CCCGTATGCAGCATCTCTGGCGG + Exonic
1203026735 16_KI270728v1_random:520650-520672 TTCTTTTGGAGCATCTGTGAAGG - Intergenic
1203044986 16_KI270728v1_random:813781-813803 TTCTTTTGGAGCATCTGTGAAGG + Intergenic
1203047341 16_KI270728v1_random:840729-840751 TCCTTTTGTAGAATCTGTGGAGG + Intergenic
1144665599 17:17100057-17100079 ACCTTTTGGAGGTCCTTTGGTGG + Intronic
1145937691 17:28724847-28724869 ATCTTTTGGAGCAGCTTTGTCGG - Exonic
1148896565 17:50842444-50842466 GCCACTGGGAGCATCTTTGGGGG + Intergenic
1155259924 18:24031757-24031779 CTCTTTTGCAGCCTCTGTGGTGG + Intronic
1157856178 18:51107580-51107602 CTCTTTTGCACCCTCTTTGGTGG - Intergenic
1161266843 19:3368049-3368071 CCCTTTCTGAGCAGCTTTGGGGG + Intronic
1161420674 19:4174643-4174665 CCCTTTTGGGGGGTCTGTGGGGG + Exonic
1162904775 19:13817209-13817231 CCCTTCTGGAGCAGCTCTGCAGG - Exonic
1163564935 19:18045454-18045476 CCCCTTTGCAGCAGCTCTGGTGG - Intergenic
1163757704 19:19116274-19116296 CCTTTTGGGGTCATCTTTGGGGG + Intergenic
1164363660 19:27548241-27548263 ACCTTTTGCAGAATCTGTGGAGG + Intergenic
1165552863 19:36603868-36603890 CCCTTTTGGAAGCTCTGTGGGGG - Intronic
926275440 2:11399933-11399955 CACTCTTGCAGCACCTTTGGGGG + Intergenic
926831026 2:16962057-16962079 CCCTTTTATCTCATCTTTGGTGG - Intergenic
927200533 2:20575556-20575578 CCCTCTTGCAGCATCCCTGGAGG + Intronic
928303799 2:30148425-30148447 GCCTTTTGGTTCCTCTTTGGTGG - Exonic
930449765 2:51520420-51520442 TCCTTTTGGAGGCTCTGTGGAGG + Intergenic
940922962 2:159330523-159330545 CACTTTTGGAGAAGCTGTGGAGG + Intronic
945138964 2:206663255-206663277 CCCTGTTGAAGCATCTTCAGTGG + Exonic
1170250849 20:14280710-14280732 ACCTTTTTAAGCATCTTTGTAGG + Intronic
1171798608 20:29586347-29586369 TCTTTTTGTAGAATCTTTGGAGG + Intergenic
1171845485 20:30270832-30270854 TCTTTTTGTAGAATCTTTGGAGG - Intergenic
1172221796 20:33279308-33279330 TGCTGGTGGAGCATCTTTGGTGG + Intronic
1172517904 20:35548365-35548387 CACATTTGGAGAATGTTTGGTGG + Intronic
1178956698 21:37029118-37029140 CCCTGCTGGCCCATCTTTGGGGG - Intergenic
1179051866 21:37895360-37895382 CCCATTAGTAGCACCTTTGGAGG + Intronic
1179276811 21:39899465-39899487 CCCCTTTGGAGCCTCTGTGGTGG + Intronic
1182801527 22:33035491-33035513 CACTTTTGAATGATCTTTGGGGG - Intronic
1182885643 22:33771779-33771801 CCTTTCTGGAGCAGGTTTGGAGG - Intronic
950434143 3:12968290-12968312 CCCTTTTGGCGGCTTTTTGGGGG + Intronic
953182350 3:40607743-40607765 CCATCTTGCAGCATCTTGGGTGG + Intergenic
953776757 3:45824825-45824847 CCCTTTTGGAGCTTTTGTTGAGG - Exonic
955952384 3:64255426-64255448 TTCCTTGGGAGCATCTTTGGAGG + Intronic
957740562 3:84262295-84262317 GCTTTTTGGAGCATCTGTGCAGG - Intergenic
958665191 3:97128161-97128183 GCCTTTTGCAGCAACTTGGGTGG - Intronic
960317033 3:116190807-116190829 CCCATCTTGGGCATCTTTGGTGG + Intronic
960868236 3:122224290-122224312 CCTTTTTGCAGAGTCTTTGGGGG - Intronic
961600028 3:128053105-128053127 TTTATTTGGAGCATCTTTGGTGG + Intronic
963342906 3:144058631-144058653 CGTTTTAGGAGCATCTATGGTGG + Intergenic
966668200 3:182496573-182496595 ACCCTTTGGAGCAGCTTTGAAGG + Intergenic
968271940 3:197409748-197409770 CTCTTCTGGAGCATGGTTGGTGG - Intergenic
970062502 4:12050852-12050874 CCCTAGTGGAGTATCTTTGTGGG - Intergenic
970118435 4:12725692-12725714 CCCTTTTGCAGCAACCTTGGGGG - Intergenic
970223709 4:13835782-13835804 CATTTATGGAGCATCTTTTGGGG - Intergenic
974374686 4:61061159-61061181 GCCTTTTGGAAAATATTTGGTGG - Intergenic
974593829 4:63990987-63991009 CATTTTTGGAGCAACTTGGGTGG + Intergenic
975830674 4:78365228-78365250 CCCTTTTGCATCATCTGTGGAGG + Intronic
978871990 4:113589921-113589943 CCCTTTTGTATCTTCTTTGCGGG - Intronic
981717928 4:147770290-147770312 CACTTTGGGAGGATCATTGGAGG + Intronic
982816061 4:159886221-159886243 TCATTTTGGGGCATCTTTGAAGG + Intergenic
988491066 5:31706067-31706089 CCCTTATAGAGGATTTTTGGTGG - Intronic
993808900 5:92449977-92449999 GCCTTTTTCAGCATCTTTAGAGG + Intergenic
995217635 5:109613660-109613682 CCCTCTTGGAGCATATTTCATGG + Intergenic
997184743 5:131870640-131870662 TCCGTTTTGAGCATCTTTAGTGG - Intronic
999560873 5:152801155-152801177 CAGTTTAGGAGCATCTTTAGAGG + Intergenic
999794104 5:154971988-154972010 CCCTTTAGGAGCAGCTATGATGG - Intergenic
999842379 5:155442657-155442679 CCTTTTTGCAGCTTCTTGGGTGG + Intergenic
1003211251 6:4069233-4069255 CACTTTTGGTGTAGCTTTGGAGG + Exonic
1004822773 6:19385891-19385913 GTCTTTTGGAGCATCTTGGAAGG + Intergenic
1007042590 6:38737404-38737426 TCATTTTTGAGGATCTTTGGTGG + Intronic
1007451464 6:41942762-41942784 CCCATTTGGAGCATTATTGGAGG - Intronic
1010414494 6:75598525-75598547 CCCTTTTAGAGTATCTTTCCTGG + Intergenic
1014501502 6:122195953-122195975 CATTTTTTGAGCATCATTGGGGG - Intergenic
1015133898 6:129846007-129846029 CCATCTTGGAGCTTCTTTAGCGG + Intronic
1019158962 6:170057040-170057062 CACTGTTGGCGCATTTTTGGTGG + Intergenic
1021341405 7:19467019-19467041 GCCTTTTGGAGAATATTTGTTGG - Intergenic
1022090128 7:27102538-27102560 CTCTTTTGGAGGGGCTTTGGGGG + Exonic
1022255370 7:28651349-28651371 CACTTTTTGAACATATTTGGTGG - Intronic
1023192912 7:37602029-37602051 CACTTTTGGAGTCTCTCTGGGGG - Intergenic
1024088519 7:45917017-45917039 CCCTTTTGGAGAATCTTATGAGG - Intronic
1025279654 7:57617816-57617838 CCTTTCTTGATCATCTTTGGGGG + Intergenic
1025305077 7:57847685-57847707 CCTTTCTTGATCATCTTTGGGGG - Intergenic
1025534842 7:61934906-61934928 TCCTTTTGGAGAATCTGTGAAGG + Intergenic
1025536164 7:61950308-61950330 TCCTTTTGTAGAATCTTTGAAGG - Intergenic
1030016101 7:105223293-105223315 CCTATTAGGAGCCTCTTTGGAGG - Intronic
1030920593 7:115380772-115380794 TCCTGTTGGAGTAACTTTGGTGG - Intergenic
1032170318 7:129578960-129578982 CCCTGTTGGAGCATCCCTGTTGG + Intergenic
1039132571 8:34283981-34284003 CTCTTTTGCAGCAACTTGGGTGG - Intergenic
1039276084 8:35935164-35935186 CCCTGTTGGATCATCTGTTGGGG - Intergenic
1040131790 8:43805534-43805556 TCCTTTTGGAGAATCTGTGAAGG + Intergenic
1040132401 8:43812597-43812619 TCTTTTTGGAGAATCTGTGGAGG + Intergenic
1040138344 8:43881601-43881623 TCTTTTTGGAGAATCTGTGGAGG - Intergenic
1040139067 8:43889168-43889190 CCTTTTTGCAGAATCTGTGGAGG + Intergenic
1040333468 8:46404241-46404263 CCCACTTGGAACAGCTTTGGGGG - Intergenic
1042320591 8:67471153-67471175 CGCATTGGGAGAATCTTTGGTGG - Intronic
1042905906 8:73771973-73771995 GCCTTTAGTAGCATCTTTGTAGG + Intronic
1043343988 8:79277478-79277500 CCCTTTGGCAGCATCTTTAAGGG - Intergenic
1044366608 8:91354805-91354827 CTATTTAGGAGCATCATTGGAGG + Intronic
1048421258 8:134280367-134280389 TCTTTTTGCAGCATCTTTGGGGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1052030738 9:23625875-23625897 ACCTTGTGGAGTATTTTTGGAGG + Intergenic
1054162592 9:61685017-61685039 TCTTTTTGTAGAATCTTTGGAGG + Intergenic
1059770212 9:117416731-117416753 ACCTTTTACAGCATCTTTGATGG - Intergenic
1061084231 9:128389955-128389977 CCCTTTTCCAGCAGCTGTGGTGG + Exonic
1062176144 9:135164184-135164206 CCCTTTTGGAGCATCTGCCGGGG - Intergenic
1203401547 Un_KI270519v1:106818-106840 TCCTTTTGTAGCATCTGTGAAGG + Intergenic
1191255062 X:58276143-58276165 CCGTTTTGGAGTGCCTTTGGTGG + Intergenic
1191261056 X:58321970-58321992 CCTTTTTGTAGAATCTTTGAAGG + Intergenic
1193968912 X:88025980-88026002 CTGTCATGGAGCATCTTTGGTGG + Intergenic