ID: 1107307108

View in Genome Browser
Species Human (GRCh38)
Location 13:39034427-39034449
Sequence CTTTCTTTGTAGAAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107307108 Original CRISPR CTTTCTTTGTAGAAGTTGGT AGG (reversed) Intronic
901273730 1:7974139-7974161 ATTTTTTTGTAGAGGTCGGTGGG - Intronic
901299489 1:8189115-8189137 AATTTTTTGTAGAGGTTGGTGGG + Intergenic
905492352 1:38354565-38354587 CTTTCTTTGAAGAAGTTTACAGG - Intergenic
905493567 1:38364678-38364700 CATTCTTTGTAGATGCTTGTAGG - Intergenic
906591294 1:47026556-47026578 GTTTCCTTGTAGAAATTGATAGG - Intronic
907504866 1:54910750-54910772 GTTGCTTTGTAGAAGGTGTTGGG + Intergenic
908404105 1:63797090-63797112 CTTTCTTACTTGAAGCTGGTGGG + Intronic
910888989 1:91997318-91997340 CATTCTTTGAAGAACTTTGTTGG + Intronic
911381657 1:97122154-97122176 CTTCCTTTGTAGATGTTTGCTGG + Intronic
912702128 1:111886217-111886239 CTTTCATTGTGTATGTTGGTGGG - Intronic
917877009 1:179294949-179294971 TTTTCTTTTTAAAAGTTGGGCGG + Intronic
917889471 1:179421100-179421122 CCTTCTTTGTCAAAGATGGTTGG + Intronic
919423135 1:197396448-197396470 TTTTTTTTGTAGAAATTGATAGG + Intronic
921289152 1:213638870-213638892 CCTTTTTTGCAGAAATTGGTAGG - Intergenic
921291991 1:213666845-213666867 CTTCCTTTGGAGAGCTTGGTAGG - Intergenic
922098961 1:222466407-222466429 CTTGCTTTGTAGAGCTTGTTGGG - Intergenic
923076361 1:230612350-230612372 TTTCCTTTGAAGTAGTTGGTTGG + Intergenic
923266077 1:232315502-232315524 CTTTTTTTCTGGAATTTGGTGGG + Intergenic
923393666 1:233539179-233539201 CTTTCTGTGTAGAATGAGGTAGG - Intergenic
923876056 1:238048703-238048725 CTCACTGTGTAGATGTTGGTGGG + Intergenic
1063583811 10:7333288-7333310 CTTTATTTGAAGAAGTTATTGGG - Intronic
1066377535 10:34870976-34870998 CTTTATTTTTAGAAATTGGCAGG + Intergenic
1066936175 10:41840350-41840372 CTCTCTTTGTAGAATTTGCCAGG - Intergenic
1066972325 10:42322702-42322724 CTTTTTTTGTAGAATTTGCAAGG + Intergenic
1070369242 10:75766168-75766190 CTTACTTTGTAAAAGTAAGTTGG - Intronic
1070396499 10:76015410-76015432 CTTTCTTGCTGGCAGTTGGTTGG + Intronic
1070951755 10:80436781-80436803 CTTTCTGTGTAAAAACTGGTTGG + Exonic
1071179559 10:82967027-82967049 CTTTCTTTGCAGAATTTCATTGG + Intronic
1072012469 10:91314744-91314766 TTTTATTTGTAGAAATTGTTTGG + Intergenic
1072085534 10:92075865-92075887 CTTTTTTGGAAAAAGTTGGTTGG + Intronic
1074212562 10:111350536-111350558 CTTTCTGTTTACAAGTTAGTGGG - Intergenic
1074953386 10:118363294-118363316 CTTTATTTGTAAAAATAGGTGGG - Intergenic
1076216055 10:128694281-128694303 CTTTCTTTGTACTATTTGGAGGG - Intergenic
1076947553 10:133661754-133661776 TTTTCTTTATAGAATTTTGTTGG + Intergenic
1077200578 11:1305431-1305453 TTTTCTTTGTAGATGTGTGTGGG - Intronic
1078246865 11:9581430-9581452 CTTTCTTGGTTGAGATTGGTTGG + Intronic
1078526892 11:12108267-12108289 CTATCTTTGTTAAACTTGGTTGG + Intronic
1078540015 11:12205864-12205886 CTTTCTCTGTAGGGGTAGGTGGG + Intronic
1079450098 11:20593346-20593368 CTTTTTTTGTCCTAGTTGGTGGG - Intergenic
1080069703 11:28066868-28066890 TTTTCTTTGTACAACTTGCTTGG + Intronic
1080460709 11:32452341-32452363 TTTTCTCTCTAGAAGTTGATAGG + Intergenic
1081086148 11:38803905-38803927 CTTTCTTTGTAAATGTATGTGGG - Intergenic
1081177088 11:39941553-39941575 CTGGCTTTGTAAAAGTTGTTTGG + Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1083546377 11:63552060-63552082 CTTCCTGTGAAGAAATTGGTGGG + Intergenic
1084643125 11:70437618-70437640 CTTTCTTTTTAGATGTGGTTGGG + Intergenic
1085993200 11:81876820-81876842 TCTTGTTTGTAGAAGCTGGTTGG - Intergenic
1086896513 11:92319247-92319269 CTTTCGTTGTTCAAGTTGATCGG + Intergenic
1088000441 11:104873891-104873913 CTTTCTTTGTAAATGGTAGTGGG + Intergenic
1088697054 11:112376368-112376390 CTTTCTTTGTTGAAGTCAGCAGG - Intergenic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1092200962 12:6582492-6582514 TTTTCTCTGTTGAAGTTGGCAGG - Intronic
1092978684 12:13771395-13771417 CTTTCTTTGTAAAACTGTGTAGG - Intronic
1093071691 12:14712114-14712136 CTGTATTTCTAGAAGTTGCTGGG - Intergenic
1093680313 12:21994687-21994709 CTTTCTTTCCAGGAGTGGGTAGG + Intergenic
1094173955 12:27523136-27523158 CTATATTTTTAGAAGATGGTGGG + Intergenic
1095161560 12:38923300-38923322 CTTACTTTGTAAATTTTGGTGGG - Intergenic
1096961340 12:55581110-55581132 GTGTCTGTCTAGAAGTTGGTTGG + Intergenic
1099195382 12:79609251-79609273 GTTTCCTTATAGAAGCTGGTTGG + Intronic
1100656188 12:96648473-96648495 CTTTCTTGGAAGATGCTGGTTGG - Intronic
1101751266 12:107584480-107584502 CATTCATTTTAGAAGTTGCTGGG + Intronic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1103372111 12:120427388-120427410 TTTTATTTGTAGAAGTTTATGGG + Intergenic
1104684139 12:130773419-130773441 CTTTCTTTGGGGAGGTTGCTGGG - Intergenic
1105073645 12:133254835-133254857 CTTTCTTGGCAGGGGTTGGTGGG - Intergenic
1106040650 13:26087924-26087946 TTTTTTTGGTAGAAGTTGATGGG - Intergenic
1106983540 13:35318735-35318757 CTTTTTTTGTTGTTGTTGGTAGG + Intronic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1111188917 13:84782428-84782450 CTTTTATTTTAGAAATTGGTAGG + Intergenic
1111456715 13:88493960-88493982 CTTTATCTGGAGAGGTTGGTTGG - Intergenic
1112587784 13:100735267-100735289 CTTTCATTAAAGAAGTAGGTTGG - Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1114526483 14:23369948-23369970 CTTCAATTGTAGAAGTGGGTGGG - Intergenic
1121073564 14:91047480-91047502 CATTCTTTGTAGAAGTAGAATGG - Intronic
1202908805 14_GL000194v1_random:97951-97973 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1125126436 15:36227662-36227684 CTTTTTTTGTAGAAATGGGGGGG - Intergenic
1125177015 15:36835291-36835313 TTTTTTTTCTAGAAGTTGATGGG + Intergenic
1125956798 15:43796069-43796091 CATTCTGGGTAGAGGTTGGTAGG + Intronic
1127486687 15:59424525-59424547 GTTTTTTCCTAGAAGTTGGTAGG + Intronic
1130079138 15:80716443-80716465 CTTACTTTGTAGAAATTGTGGGG - Intronic
1131021785 15:89105304-89105326 CTTTCTTTGTGGAAGCTCATGGG + Intronic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1134437813 16:14277677-14277699 CTGTCTTTGTAGCTGTTTGTTGG - Intergenic
1137915626 16:52426895-52426917 TTTTATTTGTACAAGTTGATGGG - Intergenic
1138674099 16:58638511-58638533 CTTTTTATGAACAAGTTGGTGGG - Intergenic
1142479271 17:208198-208220 CTTTCCTGGTAGAAGGTGGAAGG - Intergenic
1144543754 17:16172571-16172593 CTTTCTTTGTAGCAATAGCTGGG - Intronic
1146664628 17:34690270-34690292 CTTTATTTGTAGAAATTCATAGG + Intergenic
1147662041 17:42121935-42121957 ATTTTTTTGTAGAGATTGGTGGG - Exonic
1149442604 17:56687511-56687533 TTTTATTTGTAGGAGGTGGTGGG - Intergenic
1150113092 17:62519502-62519524 ACTTCTTTGTAGAAATTGGTAGG - Intronic
1151267179 17:72965936-72965958 CTTTTTTTCTAGAAATTTGTAGG - Intronic
1154142678 18:11838890-11838912 CTATCTTTGTGGAAATTGGCAGG + Intronic
1155338423 18:24789456-24789478 CTTTCTTTATAGAAATGGGGGGG - Intergenic
1156235127 18:35195865-35195887 TTTTCTTTGTATAATTTGGCAGG - Intergenic
1156954368 18:42943612-42943634 CTTTATTTTTAGAAGTGGTTTGG + Intronic
1156970959 18:43155128-43155150 TTTACTTTGTTGCAGTTGGTGGG + Intergenic
1157663278 18:49464377-49464399 CTTTCTTTGTAGAAGCTAAAGGG + Intergenic
1158353901 18:56594932-56594954 ATTTCTATATAGAAGTTGGCTGG + Intergenic
1158792296 18:60796269-60796291 CTTTTTTTGTAAAAATTGGCAGG + Intergenic
1165704217 19:37963726-37963748 CTTTCATTGTTGATTTTGGTGGG + Intronic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925448281 2:3946684-3946706 CTATTTTTGTAGAACTTTGTAGG - Intergenic
927506467 2:23618247-23618269 ATGTCTTTGTAGTAGATGGTGGG + Intronic
928194261 2:29203432-29203454 TTTTCTTTGTGGAAGTTTGCAGG + Intronic
928857370 2:35816579-35816601 CTTGTTTTGTAGAAGGTGCTGGG - Intergenic
929993246 2:46807321-46807343 CTTTCTTTATTGAAATGGGTAGG - Intergenic
932061704 2:68507242-68507264 TATGCTTTGTAGAAGTTGTTAGG + Intronic
935292983 2:101625533-101625555 CTTTCTTTCAAGAAGTTGCCGGG - Intergenic
935815744 2:106844226-106844248 CTTGTTTTGCAGAGGTTGGTGGG - Intronic
937351328 2:121164791-121164813 CTATTTTTGTAGAAATTGGCAGG - Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938297443 2:130187043-130187065 GTTTCTTTGTAGAAATGGGTGGG - Intronic
938459333 2:131487625-131487647 GTTTCTTTGTAGAAATGGGTGGG + Intronic
938725646 2:134106744-134106766 TTTTCTTTGCAGAAGTCTGTTGG + Intergenic
938770082 2:134494162-134494184 TATTCTGTTTAGAAGTTGGTAGG + Intronic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
941838842 2:170056551-170056573 GTTTATTTGTAGAAGTTGGTAGG + Intronic
941870970 2:170385259-170385281 TCTTCTTTCTAGAAGTTGGGAGG + Intronic
944260918 2:197676024-197676046 CTTTCTTGGTAGTAGTTGAGAGG - Intronic
944497281 2:200319782-200319804 CTGGCTTTGTAGCAGTTGTTAGG - Intronic
945400790 2:209379990-209380012 TTTTCTTGGTCGAAGTTGGCAGG - Intergenic
945846475 2:214950924-214950946 CTTTTTGTGGATAAGTTGGTAGG + Exonic
946300257 2:218819397-218819419 CTTTCTTTATAGAGGAAGGTTGG - Intergenic
946497309 2:220207531-220207553 CTTTATTTGTAGAAGCTACTTGG - Intergenic
946917233 2:224536368-224536390 CTTTCTTTGAAGTAATTGGTTGG - Intronic
1169079833 20:2790635-2790657 TTTTATTTGTAGAAATTGTTAGG + Intergenic
1172075390 20:32292423-32292445 AATTGTTTGTAGAAGTTGGGGGG - Intronic
1176119399 20:63447210-63447232 CTGTGTTTGTAGCAGTTGATGGG - Intronic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176628166 21:9112614-9112636 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176900731 21:14438788-14438810 ATTTCTTTGAAGAAGCTGCTAGG + Intergenic
1178339479 21:31773846-31773868 ATTTTTTTGTAGAAGTTGAGGGG - Intergenic
1178858375 21:36269030-36269052 TTTTCTTTTTAGGAGGTGGTGGG - Intronic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1182889703 22:33807042-33807064 CTGTCTTTGTGGAAGTTGCATGG - Intronic
1183269940 22:36855197-36855219 CTTACTTTTTAGCAGTTGATTGG - Intergenic
950207269 3:11090739-11090761 GTTGCTTTGTAGTAGGTGGTGGG + Intergenic
955048513 3:55385389-55385411 TTTTTTTTGTAGAAATTGATGGG + Intergenic
955618010 3:60829429-60829451 CTTTAGTAGTATAAGTTGGTAGG - Intronic
955909070 3:63841348-63841370 ATGTCTTTGTAGAATTTGGGGGG + Intronic
955990444 3:64621459-64621481 CTTTATTTGTAAAAGTAGGTAGG + Intronic
957094372 3:75764846-75764868 GTCTCTCTGTAGAAGTTGGATGG - Intronic
958174595 3:89980310-89980332 CCTTCTTTGTACAATATGGTGGG + Intergenic
958273601 3:91542762-91542784 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
958273728 3:91544972-91544994 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
958275647 3:91576471-91576493 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277560 3:91607767-91607789 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958277911 3:91613548-91613570 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293456 3:91868553-91868575 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958293976 3:91876533-91876555 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958298360 3:91948072-91948094 CTCTCTTTGTAGAACTTGCAAGG + Intergenic
958308671 3:92117518-92117540 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958345292 3:92717621-92717643 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958367954 3:93088961-93088983 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958383447 3:93342268-93342290 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
958403167 3:93714882-93714904 CTCTCTTTGTAGAATTTGCAAGG - Intergenic
960601336 3:119461998-119462020 CCTTCTTTGCAGACTTTGGTTGG - Exonic
960990520 3:123307799-123307821 CTTTCTTAATAAAAGGTGGTTGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
963621570 3:147614053-147614075 CTTTCTGCCTAGCAGTTGGTGGG + Intergenic
965664096 3:171073627-171073649 CATTCCTTGTAGAAATTTGTTGG - Intronic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969937691 4:10698634-10698656 CTTTCCTTGAAGATTTTGGTTGG - Intergenic
970256218 4:14172736-14172758 GTTGTTTTGTAGAAGTTGCTGGG + Intergenic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
970592456 4:17571328-17571350 CACTCTTTGCAGAAGCTGGTGGG - Intergenic
970802237 4:19986981-19987003 TTTTCTTGCTAGAAGTTAGTTGG + Intergenic
972724970 4:41738917-41738939 CTTTCTTTGTGCAACTTGGAGGG + Intergenic
972958891 4:44427373-44427395 TTTTCTTTATAGAACTTGCTAGG - Intronic
975773558 4:77758020-77758042 CATTCTTTGTAACATTTGGTTGG - Intronic
975897486 4:79110565-79110587 CTTTTTTTGTAAAAGTTGTTTGG + Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
977764413 4:100779705-100779727 TTTTCTTTGTAGGAATTTGTAGG - Intronic
978690402 4:111502595-111502617 ATTTTTTTGTAGAAATTGGTAGG - Intergenic
979373581 4:119917998-119918020 CTTTTTTTGTGGTTGTTGGTAGG - Intergenic
982570945 4:157050182-157050204 CTTTCTTTCTAGATGTTCTTTGG - Intergenic
983114023 4:163790092-163790114 ATTTCTTTGTAGCACTTGGTAGG + Intronic
983275708 4:165614914-165614936 ATTTCTTGGTAGTACTTGGTGGG + Intergenic
983955677 4:173696300-173696322 CTTTTTATGTAAAAATTGGTTGG - Intergenic
984592820 4:181635738-181635760 CTTTCTTTGTAGGATTTCCTGGG + Intergenic
985451009 4:190062551-190062573 TTTTCTTTATAGAATTTTGTTGG + Intergenic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
987324126 5:16796702-16796724 CGAGCTTTGTAAAAGTTGGTTGG - Intronic
987487034 5:18537171-18537193 GTTGCTTTGTAGAAGGTGCTGGG - Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
988736727 5:34029684-34029706 CTTTCTTGGTAGAAGTTTCATGG + Intronic
991199204 5:63971437-63971459 CTTTTTTTTTATAAGTTTGTTGG + Intergenic
992610055 5:78499886-78499908 GCTTCTTTCTAGAAGTTGGTCGG - Intronic
993020109 5:82581847-82581869 CTTTTTTTGTTGTTGTTGGTTGG + Intergenic
993566245 5:89479193-89479215 ATTTCTTAGTAGAAGTTGGAAGG - Intergenic
993600636 5:89919847-89919869 ATTTATTTGTAGAAGTTTTTTGG - Intergenic
995374032 5:111453469-111453491 CTTTCTGAGAATAAGTTGGTGGG + Intronic
996316047 5:122161834-122161856 CTTTCCTTGAAGAAAATGGTTGG - Intronic
997731161 5:136177914-136177936 CTTTTTTTTTTTAAGTTGGTGGG - Exonic
997921851 5:137988269-137988291 CTTACTCTGTAGAGGCTGGTAGG + Exonic
998534960 5:142921216-142921238 TTTTCTTTGTATTGGTTGGTTGG + Intronic
999912795 5:156223517-156223539 CTTTGGGTGTAGAAGTTGTTAGG + Intronic
1000681867 5:164194986-164195008 GTTTCTTTGCATAAGATGGTGGG + Intergenic
1000687893 5:164275201-164275223 GTTTATTTTTGGAAGTTGGTTGG + Intergenic
1001015215 5:168134791-168134813 CTTTGTTTGGAAAAGTGGGTGGG - Intronic
1001363785 5:171116315-171116337 CCCTCTTTGTAGAAGATGGGAGG - Intronic
1001782722 5:174384290-174384312 CTTTCTTTGTGGATGTTTGTAGG + Intergenic
1003933142 6:10947115-10947137 TTTTATTTCTAGAAGTTGTTTGG + Intronic
1005255161 6:23994673-23994695 CTTACTTTGTCGAAGATAGTTGG - Intergenic
1008476788 6:51942001-51942023 GTTGTTTTGTAGAAGGTGGTGGG - Intronic
1009136748 6:59548427-59548449 CTTTTTTTGTAGAATTTGCAAGG + Intergenic
1009255222 6:61382831-61382853 CTCTCTTTGTAGAATTTGCAAGG + Intergenic
1009281956 6:61763511-61763533 CATTCGTTTTAGAACTTGGTCGG - Intronic
1010811271 6:80301640-80301662 CTGTCTTTGTAGAATTAGTTAGG - Intronic
1010843947 6:80681697-80681719 CTTTATTTTTAGAAGATTGTGGG + Intergenic
1012883448 6:104817636-104817658 CTGTCTTTGTAGAAGAGAGTAGG + Intronic
1015186919 6:130427993-130428015 CTATCCTTGTAGAAAGTGGTAGG + Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1023063987 7:36357017-36357039 TTTTCTTTCTCTAAGTTGGTGGG + Exonic
1023576581 7:41634666-41634688 CTTTATTTGATGAAGTTGTTTGG - Intergenic
1024808743 7:53182221-53182243 CTTTCTCAGTAGGAGTTGGAAGG - Intergenic
1027887408 7:83927055-83927077 CCTTCTTTTTAGAAATTGGCAGG - Intergenic
1028492518 7:91428011-91428033 CTTTGTTTGTGTAAGGTGGTGGG - Intergenic
1028733377 7:94178966-94178988 CTTCCCTGGTTGAAGTTGGTTGG - Intergenic
1029989282 7:104948248-104948270 CTTTTTTTGTAGATCTAGGTAGG + Intergenic
1030186212 7:106764657-106764679 GTTGCTTTGTGGAATTTGGTGGG - Intergenic
1030769143 7:113451864-113451886 CCTTCCTTGTACAAGTTTGTTGG - Intergenic
1030998181 7:116383943-116383965 CTTTCACTGTAGAGGTTGGCAGG - Intronic
1031368117 7:120928092-120928114 GTTTCTTAGTCGAACTTGGTAGG + Intergenic
1031404681 7:121370122-121370144 CTTGCATTTTAGAAGTTTGTAGG - Intronic
1032042298 7:128573443-128573465 ACTTCTTTGTAGAAATTGGTAGG - Intergenic
1034115509 7:148580308-148580330 TTATTTTTGTAGAAGTTGGGGGG - Intergenic
1038547517 8:28436923-28436945 CATTTTTTGTAGAGATTGGTGGG + Intronic
1038619179 8:29123813-29123835 CTTTCTTTGTAGGGGGTGGGAGG + Intronic
1040128736 8:43769426-43769448 CTTTCTTTGATTCAGTTGGTTGG + Intergenic
1041828152 8:62121844-62121866 CTTTCTCTGTGGTAGTTGGGTGG + Intergenic
1042356472 8:67833956-67833978 CTCTCTTTGTTAGAGTTGGTAGG + Intergenic
1042679971 8:71372182-71372204 TTTTCTCTCTAGAAGTTTGTAGG - Intergenic
1044238410 8:89858234-89858256 CTTTCTTTTTAGGGGTTGGGGGG + Intergenic
1044252390 8:90019225-90019247 TTTCCTTTGTACATGTTGGTGGG - Intronic
1045247879 8:100459379-100459401 TTTGCTTTGTAGAAGTAGTTTGG + Intergenic
1046312665 8:112458987-112459009 CATTGTTTGTAGAAGATAGTAGG - Intronic
1047231528 8:123001974-123001996 CTTTCTTGATAGCAGGTGGTGGG - Intergenic
1050240103 9:3626002-3626024 CTTTCTTTGTGGATATTGCTGGG + Intergenic
1050419799 9:5451610-5451632 CTTTCTCAGTAAAAGTAGGTAGG + Intronic
1051295703 9:15593165-15593187 CTTTCTTTCTATAAGTTAGGAGG + Intronic
1052231254 9:26156509-26156531 CTTTCTATGTATAAGGTGCTAGG - Intergenic
1053400187 9:37812241-37812263 TTGTTTTTGAAGAAGTTGGTAGG - Intronic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057696988 9:97330142-97330164 TTTTCCTTGTAGAACTTGGCTGG + Exonic
1058125580 9:101190567-101190589 GTTTATTTGTGGCAGTTGGTGGG + Intronic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1058906684 9:109487678-109487700 TTCTCTATGTAGAAGTTGCTAGG - Intronic
1061075096 9:128336376-128336398 GTTTCTAGGCAGAAGTTGGTAGG - Intergenic
1203751010 Un_GL000218v1:80294-80316 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1203482976 Un_GL000224v1:24049-24071 CTGTCTCTGTAGTAGTTGGATGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1189517841 X:41733261-41733283 CTTTTTTTGTAGGAGTAGGCTGG + Intronic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1190557939 X:51655701-51655723 CTTTGTTTGTATAAATTGGTTGG + Intergenic
1191894950 X:65982483-65982505 TTTTCTTTGTGGAAGTTGAAAGG - Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1192724850 X:73738512-73738534 CCTTTTTTATGGAAGTTGGTCGG + Intergenic
1192913917 X:75634344-75634366 GTTGCTTTGTAGAAGGTGTTGGG + Intergenic
1193822130 X:86178319-86178341 CTTTTTTTGTATAAATTGTTAGG + Intronic
1194421728 X:93683089-93683111 GTTACTATTTAGAAGTTGGTTGG - Intronic
1195984247 X:110612074-110612096 CTTTTTTTGTTGTTGTTGGTAGG - Intergenic
1196266899 X:113660355-113660377 CTTTTTTTGTTGTTGTTGGTAGG - Intergenic
1199705514 X:150421702-150421724 CTTTCTTTTTAGAACGTGTTGGG + Intronic
1200813038 Y:7504232-7504254 GTTGCTTTGTAGAAGTGGTTGGG - Intergenic
1201164663 Y:11197917-11197939 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic