ID: 1107310316

View in Genome Browser
Species Human (GRCh38)
Location 13:39070419-39070441
Sequence ATGTGCAAGTGGAAATGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107310316_1107310318 21 Left 1107310316 13:39070419-39070441 CCTTGACATTTCCACTTGCACAT No data
Right 1107310318 13:39070463-39070485 ACATGTGCAAAATAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107310316 Original CRISPR ATGTGCAAGTGGAAATGTCA AGG (reversed) Intergenic
No off target data available for this crispr