ID: 1107310318

View in Genome Browser
Species Human (GRCh38)
Location 13:39070463-39070485
Sequence ACATGTGCAAAATAGATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107310317_1107310318 10 Left 1107310317 13:39070430-39070452 CCACTTGCACATGTAATCATTAT No data
Right 1107310318 13:39070463-39070485 ACATGTGCAAAATAGATATTTGG No data
1107310316_1107310318 21 Left 1107310316 13:39070419-39070441 CCTTGACATTTCCACTTGCACAT No data
Right 1107310318 13:39070463-39070485 ACATGTGCAAAATAGATATTTGG No data
1107310315_1107310318 24 Left 1107310315 13:39070416-39070438 CCTCCTTGACATTTCCACTTGCA No data
Right 1107310318 13:39070463-39070485 ACATGTGCAAAATAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107310318 Original CRISPR ACATGTGCAAAATAGATATT TGG Intergenic
No off target data available for this crispr