ID: 1107315269

View in Genome Browser
Species Human (GRCh38)
Location 13:39124797-39124819
Sequence CCTACTAGTTAGAGGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107315269_1107315273 1 Left 1107315269 13:39124797-39124819 CCTTCCTACCTCTAACTAGTAGG No data
Right 1107315273 13:39124821-39124843 AATAACTGATATTTCGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107315269 Original CRISPR CCTACTAGTTAGAGGTAGGA AGG (reversed) Intergenic
No off target data available for this crispr