ID: 1107324693

View in Genome Browser
Species Human (GRCh38)
Location 13:39229111-39229133
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107324693_1107324694 -9 Left 1107324693 13:39229111-39229133 CCAAGCAGTTCAGAACAAGACTC No data
Right 1107324694 13:39229125-39229147 ACAAGACTCATGTTGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107324693 Original CRISPR GAGTCTTGTTCTGAACTGCT TGG (reversed) Intergenic
No off target data available for this crispr