ID: 1107328243

View in Genome Browser
Species Human (GRCh38)
Location 13:39268777-39268799
Sequence GTGTATTAATAGAAATGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107328240_1107328243 -4 Left 1107328240 13:39268758-39268780 CCCTCTGTGTTAAAATACAGTGT No data
Right 1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG No data
1107328241_1107328243 -5 Left 1107328241 13:39268759-39268781 CCTCTGTGTTAAAATACAGTGTA No data
Right 1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG No data
1107328237_1107328243 10 Left 1107328237 13:39268744-39268766 CCTTCAATGTCACCCCCTCTGTG No data
Right 1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG No data
1107328239_1107328243 -3 Left 1107328239 13:39268757-39268779 CCCCTCTGTGTTAAAATACAGTG No data
Right 1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG No data
1107328238_1107328243 -2 Left 1107328238 13:39268756-39268778 CCCCCTCTGTGTTAAAATACAGT No data
Right 1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107328243 Original CRISPR GTGTATTAATAGAAATGTGG AGG Intergenic
No off target data available for this crispr