ID: 1107328834

View in Genome Browser
Species Human (GRCh38)
Location 13:39274891-39274913
Sequence GGAGAGAAGCAGAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107328822_1107328834 26 Left 1107328822 13:39274842-39274864 CCCTGTTCACAGTCCTTGACAGT No data
Right 1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG No data
1107328823_1107328834 25 Left 1107328823 13:39274843-39274865 CCTGTTCACAGTCCTTGACAGTG No data
Right 1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG No data
1107328825_1107328834 13 Left 1107328825 13:39274855-39274877 CCTTGACAGTGCTCTCAGGAGAA No data
Right 1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG No data
1107328821_1107328834 27 Left 1107328821 13:39274841-39274863 CCCCTGTTCACAGTCCTTGACAG No data
Right 1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107328834 Original CRISPR GGAGAGAAGCAGAATGGGGA AGG Intergenic
No off target data available for this crispr