ID: 1107338760

View in Genome Browser
Species Human (GRCh38)
Location 13:39383804-39383826
Sequence CCACATTCACACCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107338760 Original CRISPR CCACATTCACACCTGCAGCC AGG Intronic
900094018 1:933075-933097 CCACCTCCTGACCTGCAGCCCGG + Intronic
900522867 1:3114668-3114690 ACACATGCACACATGCACCCGGG + Intronic
900569941 1:3353284-3353306 CCCATTTCTCACCTGCAGCCTGG + Intronic
900572365 1:3364941-3364963 CCTCATTCCCTCGTGCAGCCTGG + Intronic
900898469 1:5500584-5500606 GAACATTCACACCAGCCGCCAGG + Intergenic
901581300 1:10246049-10246071 CCAGATTCACTTCTGTAGCCTGG + Intronic
902787057 1:18739612-18739634 ACACAGCCACACCTGCAGCCTGG + Intronic
905152383 1:35940981-35941003 CCACATTTACACCTCCAGCCTGG + Intronic
909713852 1:78683306-78683328 GCACCTTCACAGCTCCAGCCAGG - Intergenic
915066759 1:153231401-153231423 ACACCTGGACACCTGCAGCCAGG - Intergenic
915449652 1:155995718-155995740 CCAAATTCAACCCTGCAGGCTGG - Intronic
915653424 1:157336774-157336796 ACACCCTCACACCTCCAGCCTGG - Intergenic
915797427 1:158751941-158751963 CCCCCTTCACACCTACAGCCTGG - Intergenic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
917436098 1:175023184-175023206 CCAAATTGACATCTGCAGCTCGG + Intronic
917855931 1:179099661-179099683 CCACATACACACCTGCGGGGCGG + Exonic
919346376 1:196384661-196384683 CCACACTCCAGCCTGCAGCCTGG + Intronic
919664891 1:200282569-200282591 CCTGAACCACACCTGCAGCCTGG + Intergenic
920547278 1:206828957-206828979 CCTCATGCACACCTGTAGTCAGG - Intronic
1062962587 10:1584439-1584461 CCACATCCTCACCAGCATCCAGG - Intronic
1062965349 10:1603183-1603205 ACACATTCACACATGTGGCCGGG + Intronic
1063371316 10:5524756-5524778 CCCGAATCACACCTGCAGTCAGG - Exonic
1064343357 10:14507230-14507252 CCCCATTCATTCCTGCAACCAGG + Intergenic
1067227217 10:44384166-44384188 CCCCAAACACACCTGCAGACAGG - Intronic
1067509138 10:46880973-46880995 CAAAAATCACACCAGCAGCCCGG + Intergenic
1070699575 10:78591261-78591283 CTAGTTTCACAACTGCAGCCAGG - Intergenic
1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG + Intergenic
1074816318 10:117143514-117143536 CTACATTCCCACCTCCACCCAGG + Intergenic
1074914745 10:117944564-117944586 CCTCATCCACCCCTGCACCCAGG - Intergenic
1075339083 10:121631229-121631251 CCACACTCAAACCAGAAGCCAGG + Intergenic
1075572968 10:123558743-123558765 GCTCAATCCCACCTGCAGCCTGG - Intergenic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1076333024 10:129685374-129685396 CCAGATTCACACTGGCTGCCTGG - Intronic
1077102520 11:828467-828489 CCACCTTCCCACCTGCTGCAGGG + Intronic
1077393769 11:2311337-2311359 CCACATTCATCCCTGAAGCCCGG - Intronic
1077536048 11:3124754-3124776 GCCCATTCACACCGGCAGCTGGG + Intronic
1078572468 11:12471294-12471316 CCACATTTAAATCTCCAGCCTGG - Intronic
1079182249 11:18204214-18204236 CCACATGCTCTCCTGCACCCTGG + Intronic
1080864346 11:36180097-36180119 CCACATTCAGTTCTGCATCCTGG + Intronic
1081613914 11:44579357-44579379 CCACACCCACCCCTGGAGCCAGG - Intronic
1081976520 11:47238804-47238826 CCACATTCTCATCTGGAGCCAGG + Exonic
1083366680 11:62145571-62145593 CCACATTCAATCCTGCAGAGTGG - Intronic
1083961429 11:66016912-66016934 CCCCACTCACCCCTGCAGGCTGG - Exonic
1084394725 11:68901732-68901754 CCAAGTTTACACCTCCAGCCAGG + Intronic
1084534847 11:69750644-69750666 CCACCTTCACACCTGGGGCACGG - Intergenic
1085803446 11:79612777-79612799 CCAAATTTACACCTCCAGCCAGG + Intergenic
1087281471 11:96215696-96215718 CCTCCTCCACACCTGCAGCTGGG + Intronic
1088401421 11:109424746-109424768 CCCCATTCCCACCCTCAGCCGGG + Exonic
1089734598 11:120541054-120541076 CCACATACTGCCCTGCAGCCTGG + Intronic
1089790836 11:120942357-120942379 CCACATTGACCCCTGGAGTCGGG + Intronic
1090648545 11:128786616-128786638 ACACACGCACATCTGCAGCCTGG - Intronic
1095356472 12:41280757-41280779 CCACATCCACCCCTTCTGCCTGG - Intronic
1096426408 12:51507634-51507656 CCACATTCACATCTGGTGACTGG - Exonic
1096535033 12:52266659-52266681 CGACATTGTCACCTGCAGCTGGG + Intronic
1096538078 12:52288013-52288035 CGACATTGTCACCCGCAGCCGGG - Exonic
1099463504 12:82953234-82953256 CCACGATCAAACATGCAGCCAGG - Intronic
1101396430 12:104352370-104352392 CCACAGTCCCATCTGCAGGCTGG - Intergenic
1103779419 12:123389172-123389194 CGACACACCCACCTGCAGCCCGG - Intronic
1104606495 12:130193284-130193306 CCACAATCTCGCTTGCAGCCTGG - Intergenic
1106557024 13:30818623-30818645 CCACATCCACCCCTCCAGCCTGG + Intergenic
1107338760 13:39383804-39383826 CCACATTCACACCTGCAGCCAGG + Intronic
1113356971 13:109590150-109590172 CCAAAGTCACACATGCAACCGGG + Intergenic
1114348643 14:21825346-21825368 ACACATTCAGACCTGCAGGCGGG - Intergenic
1114686539 14:24537362-24537384 GCACATTCACACTGGCAGCAAGG - Intergenic
1115190590 14:30743729-30743751 CCAAAGTCACACCTGCTTCCTGG - Intergenic
1116076744 14:40120414-40120436 CCACATTGATACCTGAAGTCTGG + Intergenic
1117409333 14:55436687-55436709 TCCCATTCACAGCTGCACCCTGG - Exonic
1120640049 14:86999834-86999856 CAATATTCACATCTTCAGCCTGG + Intergenic
1121629905 14:95414315-95414337 CCACATCGACACCTGCCCCCAGG - Intronic
1122251488 14:100443075-100443097 CCAGGTTTCCACCTGCAGCCGGG - Intronic
1122814507 14:104305885-104305907 CCACACACACACCTGCGGCCAGG - Intergenic
1123003207 14:105307662-105307684 TCACCTTCTCACCTGCTGCCTGG + Exonic
1123121025 14:105917184-105917206 CCACATTCCCACCTGGAACAGGG - Intergenic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1125815845 15:42583478-42583500 TCACATATACACCTTCAGCCTGG - Intronic
1128358817 15:66946364-66946386 CCTGATTTACACCTGCTGCCCGG - Intergenic
1129672659 15:77615889-77615911 CCTCTTGCTCACCTGCAGCCGGG + Exonic
1129770034 15:78197230-78197252 CCCCACTCCCACCTCCAGCCCGG - Intronic
1129839289 15:78733930-78733952 CCACATCCTCTCCTGCTGCCGGG - Intergenic
1131897580 15:97050411-97050433 CCCCATTCCCAGATGCAGCCTGG + Intergenic
1132146453 15:99432568-99432590 CCAGGTTCAGACCTGCATCCTGG - Intergenic
1132207716 15:99997943-99997965 CCACATTCAGAGCTTCTGCCGGG - Intronic
1133729219 16:8565676-8565698 CCACTCTCACCCCTGCAGGCCGG + Intergenic
1133895844 16:9928165-9928187 GCTCATTCACACCTGCAGGCAGG + Intronic
1134621682 16:15694189-15694211 CCCCCCTCACACCTGCGGCCCGG + Exonic
1135190308 16:20348913-20348935 CCACATTGACACATGTGGCCAGG + Exonic
1136346430 16:29679114-29679136 CCACAGTCCCACCCCCAGCCTGG + Exonic
1136655716 16:31707994-31708016 CCACATGAACATCTGCAGCTTGG - Intergenic
1137290852 16:47051022-47051044 CCACATACACACCTGCAAGGAGG + Intergenic
1137395764 16:48115303-48115325 CCACATTCCCAGCTGAAGACAGG + Intronic
1137726130 16:50658008-50658030 CCACACACTCACCTGCAGCCTGG + Intergenic
1138278732 16:55756501-55756523 CGACATTCTCCACTGCAGCCTGG - Intergenic
1138289820 16:55837133-55837155 CGACATTCTCCACTGCAGCCTGG + Intergenic
1140584817 16:76277166-76277188 CCCCACTCACACCTCCAGCTGGG + Intergenic
1141603371 16:85139404-85139426 GCACATGCACTCCTGCTGCCAGG - Intergenic
1141940714 16:87274221-87274243 CCCCTTTTATACCTGCAGCCCGG + Intronic
1142204102 16:88774587-88774609 CCCCACTCAGACCTGCAGCTGGG - Intronic
1142962336 17:3558635-3558657 CCCACTTCACAGCTGCAGCCTGG - Intergenic
1143012249 17:3872441-3872463 CCACCTTCATATCTGCAGGCTGG + Intronic
1144336810 17:14278796-14278818 CCACACTGACATCTCCAGCCTGG - Intergenic
1146319356 17:31834452-31834474 CCAAATTTACATCTGTAGCCTGG - Intergenic
1146504631 17:33394349-33394371 CCAAATTCCAACTTGCAGCCAGG - Intronic
1146920032 17:36704082-36704104 CCCCACCCACACCTCCAGCCCGG - Intergenic
1148106129 17:45119978-45120000 GCACATGCACACCTGTAGGCTGG + Intronic
1148544706 17:48508764-48508786 CCACATGCACACCTGTACCATGG - Intergenic
1150225155 17:63520692-63520714 ACACACACACACCTGCTGCCTGG + Intronic
1151764334 17:76124430-76124452 CCTGCTTCACCCCTGCAGCCTGG - Intergenic
1151969599 17:77450900-77450922 AGCCATTCAGACCTGCAGCCAGG - Intronic
1151989401 17:77564567-77564589 CAGCATTCAGCCCTGCAGCCTGG + Intergenic
1152192520 17:78897229-78897251 CCACAGTCAGGCCTGCACCCCGG + Intronic
1152202457 17:78955047-78955069 CCACGTTCCCACCTGGTGCCGGG + Intergenic
1152437777 17:80286704-80286726 ACAGGTTCACACCTGCTGCCTGG + Intronic
1152717508 17:81907038-81907060 CCACAGTCCCACCTGCCACCTGG - Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153811169 18:8753136-8753158 GCACATTCATACCTGGACCCAGG + Intronic
1154295585 18:13144207-13144229 CTACATTCTCATCTGCAGCTTGG + Intergenic
1155502530 18:26501100-26501122 CCACATGTACACCAGCAGCCTGG - Exonic
1155964992 18:32027172-32027194 GCACTTTCACCACTGCAGCCTGG - Intronic
1156505327 18:37587099-37587121 CTACATTCCAACCTGCAGGCAGG + Intergenic
1157148907 18:45194989-45195011 GCCCATTCACGCCTGAAGCCAGG - Intergenic
1157407002 18:47430076-47430098 CCTCATGGACACCTTCAGCCTGG + Intergenic
1160014673 18:75131588-75131610 CCAACTTCACACATGCAGGCTGG - Intergenic
1160580146 18:79879085-79879107 CCTCAATGACTCCTGCAGCCTGG - Intronic
1161043018 19:2120223-2120245 ACACATTCCCACCTCCAGGCAGG + Intronic
1161563718 19:4987897-4987919 CCACATTCAACCCACCAGCCAGG - Intronic
1163723881 19:18911489-18911511 CCACTGTCACATCTGCAGCTGGG + Intronic
1164089154 19:21932508-21932530 TCACAATCACACCTGCAGAAAGG - Intergenic
1164100307 19:22048861-22048883 TCACAATCACACCTGCAGGGTGG + Intergenic
1164193417 19:22932309-22932331 TCACAATCACACCTGCAGAAAGG - Intergenic
1164204797 19:23049172-23049194 TCACAATCACACCTGCAGAAAGG + Intergenic
1164227265 19:23256804-23256826 TCACAATCACACCTGCAGGAAGG + Intergenic
1164232836 19:23306293-23306315 TCACAATCACACCTGCAGGAAGG - Intronic
1164325872 19:24190929-24190951 TCACATTTACACCTGCAGGAAGG + Intergenic
1164663678 19:30005647-30005669 CAACAATATCACCTGCAGCCTGG - Exonic
1164889584 19:31812038-31812060 ACACATTCCCACCATCAGCCGGG - Intergenic
1165158263 19:33801292-33801314 CCACATGTACACCAGCAGCCTGG + Exonic
1166329883 19:42071658-42071680 CCAGATTCACACCTGCCTCTGGG + Intronic
1166891946 19:45999407-45999429 CCACATTCACACGCGTGGCCTGG - Intronic
1167243586 19:48360060-48360082 CCCCGTCCTCACCTGCAGCCGGG + Exonic
1168475253 19:56670490-56670512 CCACACTCACACATGCACACAGG + Intronic
925278035 2:2664134-2664156 TCACATTCACACGTGCAGACAGG + Intergenic
925309892 2:2875023-2875045 CCACAGTGTCACCCGCAGCCCGG + Intergenic
926795746 2:16617572-16617594 CCTCATTAAGGCCTGCAGCCAGG + Intronic
927467883 2:23350745-23350767 TCACCTGCACACCTGCTGCCTGG + Intergenic
929450796 2:42035734-42035756 CCACATCAACACCTGCTCCCTGG + Intergenic
932573742 2:72951525-72951547 GCACACACACACCTGCAGCCAGG + Intronic
932959673 2:76397956-76397978 ACACATTCTCACCACCAGCCAGG + Intergenic
934553216 2:95274701-95274723 TGACATTCACCCCAGCAGCCAGG + Exonic
934646799 2:96063655-96063677 CAACATTCACAGCTGCAGGATGG - Intergenic
934840201 2:97619737-97619759 CAACATTCACAGCTGCAGGATGG - Intergenic
936981492 2:118269328-118269350 TCACATCCTCACCAGCAGCCGGG - Intergenic
938950293 2:136249090-136249112 CCACATTCACAAGTGCACCGTGG - Intergenic
939375442 2:141359679-141359701 CCACTGTCACATCTGCTGCCCGG - Intronic
942092735 2:172509730-172509752 GCTAATTCACACCTGCAGCGTGG - Intergenic
943014050 2:182489830-182489852 CCACATTTATATCTGCAGCCTGG - Intronic
944652560 2:201846134-201846156 CTACAGTCACAACTGCAGCCTGG - Intronic
946337666 2:219049409-219049431 CCTGAGTCACACCTGCTGCCTGG - Intergenic
946374465 2:219299755-219299777 GCAGCTTCACTCCTGCAGCCAGG + Exonic
948151812 2:235750556-235750578 CCACATGCACAAGTGCAGGCAGG - Intronic
948587347 2:239027745-239027767 CCAGATTCACACCCGAGGCCTGG - Intergenic
948678038 2:239610634-239610656 CTGCATCCACACCTGCAGCCTGG - Intergenic
948819917 2:240537178-240537200 CCCCACCCTCACCTGCAGCCAGG + Intronic
948932581 2:241141630-241141652 TCACACTCGCACCTCCAGCCTGG + Intronic
1169158560 20:3356066-3356088 CCAAGATCACACCTCCAGCCTGG - Intronic
1173155886 20:40608313-40608335 CCAAACTCACACCTCCAGCCAGG - Intergenic
1173252626 20:41372604-41372626 CAGTAATCACACCTGCAGCCAGG - Intergenic
1174183309 20:48688570-48688592 CCCCATCCACCCATGCAGCCTGG - Intronic
1174611930 20:51804850-51804872 CCAGTTTAACAGCTGCAGCCAGG + Intergenic
1175360462 20:58406189-58406211 CCAAATTTATATCTGCAGCCTGG - Intronic
1177189089 21:17829801-17829823 GCACATTCACCCCTTCAGCCAGG + Intergenic
1177829030 21:26116419-26116441 CCAGATTCACATCTGCAGACTGG - Intronic
1178291407 21:31371847-31371869 ACTCATTCACCCCTTCAGCCCGG + Intronic
1178708991 21:34897634-34897656 CCACATGGAAACCTGAAGCCAGG - Intronic
1179416605 21:41203514-41203536 CCTCATTCACCCTCGCAGCCAGG - Intronic
1179781025 21:43701127-43701149 ACACACACACAGCTGCAGCCAGG + Intergenic
1180150113 21:45943058-45943080 CCACCTCCACACCTGGATCCTGG + Intergenic
1180870968 22:19147233-19147255 CCACATTTACATCTCAAGCCAGG - Intergenic
1181482892 22:23212212-23212234 CCACATGGACCCCTACAGCCCGG + Intronic
1181837988 22:25626770-25626792 CGATCTTCAAACCTGCAGCCTGG - Intronic
1182004119 22:26944833-26944855 CCACATCAACACTTGCAGGCAGG + Intergenic
1182037009 22:27206811-27206833 CCACATTCATTTGTGCAGCCAGG - Intergenic
1183871998 22:40746970-40746992 ACACATACATACCTGCACCCAGG - Intergenic
1183945087 22:41320896-41320918 CCACATGCACACATGCTCCCTGG + Intronic
1184682496 22:46079779-46079801 CCAGATTGAAACCTGCAGCCTGG + Intronic
1185080150 22:48705217-48705239 GCACCTTCACACCCACAGCCAGG - Intronic
949395674 3:3612493-3612515 CCACATCCTCACTTGCAGGCTGG + Intergenic
950145351 3:10645990-10646012 AGACATTGACACATGCAGCCTGG + Intronic
950208029 3:11095023-11095045 GCAGCTTCACTCCTGCAGCCAGG + Intergenic
950692258 3:14669139-14669161 CCACATGCTCAGCTGCAACCGGG + Intronic
953043035 3:39271919-39271941 CCACACTCGCATCTGCTGCCAGG - Intronic
954120952 3:48499641-48499663 CCACATTCCAGCCTGCAGCCTGG + Intronic
954279072 3:49563184-49563206 GCACATTCAAGCCTGGAGCCAGG + Intronic
960806071 3:121585105-121585127 CCACATTCACCTATCCAGCCTGG + Intronic
960997373 3:123349004-123349026 CCCCATTCACGCCTGCACTCTGG + Intronic
961002555 3:123383759-123383781 CCACATCCACACATGCAGGCAGG + Intronic
961165958 3:124764050-124764072 CAACACTCACACCTGCAGTCTGG - Intronic
961435505 3:126913723-126913745 CCACACTCCCACCTGGAGCACGG + Intronic
962039913 3:131695951-131695973 CCACTCTCACATCTGCAACCTGG - Intronic
962421999 3:135237178-135237200 CCACATCCACACCTGCCAGCAGG - Intronic
964548003 3:157856511-157856533 CCACATTAATCCCTGCAGTCAGG + Intergenic
964664782 3:159160215-159160237 CAACACTCACACCTTCATCCGGG + Intronic
965276917 3:166695523-166695545 TCTCATTCAGAGCTGCAGCCTGG + Intergenic
968926179 4:3549599-3549621 CCACATCCACACAGGCAGACCGG - Intergenic
968966334 4:3770803-3770825 CCAGCTTCTCCCCTGCAGCCTGG - Intergenic
969603364 4:8189758-8189780 CCTCATTCTGAGCTGCAGCCTGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971568337 4:28175120-28175142 CCAGAACCAAACCTGCAGCCTGG - Intergenic
973065018 4:45779276-45779298 CCTCATTCTCCCCTTCAGCCAGG + Intergenic
976825945 4:89260326-89260348 CCACATTCTCTCAGGCAGCCTGG - Intronic
980663644 4:135899730-135899752 CAGCATGCACACCTGTAGCCTGG + Intergenic
985599315 5:818214-818236 CCACATGCACACCTGCTGCCGGG - Intronic
986171757 5:5320135-5320157 CCACCCTAACACCCGCAGCCTGG - Exonic
988582241 5:32478330-32478352 CTACAGTCACACCAGCAGGCTGG - Intergenic
988619245 5:32805431-32805453 CCACATTCCCATCTGTAGACTGG + Intergenic
988751640 5:34193517-34193539 CCCCCTTCACACCTGCAAGCAGG + Intergenic
988964211 5:36400407-36400429 CCACATTCCAAGCTGCTGCCTGG + Intergenic
991038841 5:62155477-62155499 TCACCTCCAAACCTGCAGCCAGG - Intergenic
991736433 5:69633815-69633837 CCACCTTCACAGCTGCAAGCAGG + Intergenic
991736608 5:69634628-69634650 CCACCTTCACAGCTGCAAGCAGG + Intergenic
991736956 5:69636263-69636285 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991739391 5:69654296-69654318 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991758109 5:69898883-69898905 CCCCCTTCACACCTGCAAGCAGG - Intergenic
991758283 5:69899699-69899721 CCACCTTCACAGCTGCAAGCAGG - Intergenic
991758457 5:69900515-69900537 CCACCTTCACAGCTGCAAGCAGG - Intergenic
991758630 5:69901328-69901350 CCACCTTCACAGCTGCAAGCAGG - Intergenic
991788529 5:70215987-70216009 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991790966 5:70234037-70234059 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991812931 5:70489454-70489476 CCACCTTCACAGCTGCAAGCAGG + Intergenic
991813281 5:70491092-70491114 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991815889 5:70509931-70509953 CCACCTTCACAGCTGCAAGCAGG + Intergenic
991816062 5:70510744-70510766 CCACCTTCACAGCTGCAAGCAGG + Intergenic
991816413 5:70512373-70512395 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991818853 5:70530413-70530435 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991837512 5:70774765-70774787 CCCCCTTCACACCTGCAAGCAGG - Intergenic
991837686 5:70775581-70775603 CCACCTTCACAGCTGCAAGCAGG - Intergenic
991837859 5:70776394-70776416 CCACCTTCACAGCTGCAAGCAGG - Intergenic
991880977 5:71216351-71216373 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991883414 5:71234372-71234394 CCCCCTTCACACCTGCAAGCAGG + Intergenic
991965647 5:72087499-72087521 CCTCATTCAAACCTGAAACCTGG + Intergenic
992488186 5:77215839-77215861 CAACATTCCCACCTGCTCCCTGG - Intronic
992748013 5:79837877-79837899 CGACATTTCCACCTGCAGTCTGG + Intergenic
997725948 5:136120000-136120022 CCACATGCATGCCTGCTGCCAGG - Intergenic
1001528480 5:172445834-172445856 CCAGATGCACACCTGCAGGCGGG - Intronic
1001615791 5:173042562-173042584 CCACATTCTAACCTCCAGCCTGG - Intergenic
1001794515 5:174490949-174490971 CCTCATTCCCACCTGTTGCCTGG - Intergenic
1004418739 6:15448730-15448752 CCACATTCCAACCAGCTGCCAGG - Intronic
1005298513 6:24449286-24449308 CCACAGTCACACATGGTGCCCGG + Intronic
1006147406 6:31967852-31967874 CCACACTCTCACCTTCAGGCAGG - Exonic
1007396814 6:41582730-41582752 CCACATCCACCCCTGCAGCCTGG + Intronic
1012500624 6:99884294-99884316 CCACATTCACCCCTGGACACAGG + Intergenic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1018927659 6:168217595-168217617 CCACAGTTACCCCAGCAGCCTGG - Intergenic
1019180240 6:170182285-170182307 CCACACGTACACCTGCAGGCAGG + Intergenic
1020000636 7:4753793-4753815 CCAGAGCCTCACCTGCAGCCGGG + Intronic
1022037338 7:26547046-26547068 CTATCCTCACACCTGCAGCCGGG + Intergenic
1024222526 7:47299668-47299690 CCCCTTGCACCCCTGCAGCCTGG - Intronic
1024231378 7:47366556-47366578 GCACACTCAGACCTGAAGCCAGG + Intronic
1025032048 7:55565734-55565756 CCACCTCCACCCCTGCAGCCAGG - Intronic
1025161651 7:56666585-56666607 TCACAATCACACCTGCAGAAAGG - Intergenic
1025194037 7:56918719-56918741 CCACATTCAGAGCTGCATGCAGG + Intergenic
1025677909 7:63658225-63658247 CCACATTCAGAGCTGCATGCAGG - Intergenic
1025722689 7:64030634-64030656 CCACAATCACACCTGCGGGAAGG + Intronic
1025744215 7:64228566-64228588 CCACAATCACACCTGCGGGAAGG + Exonic
1025745835 7:64241912-64241934 TCACAATCACACCTGCAGAAAGG + Intronic
1025751426 7:64296971-64296993 CCACAATCACACCTGCGGGAAGG + Intergenic
1025782099 7:64611012-64611034 CCAAAATCACACCTGCAGGATGG - Intergenic
1026032209 7:66803982-66804004 CAACATTCACACCTGCTGATTGG - Intronic
1026257620 7:68726161-68726183 TCACGTTCACACCTGCTACCAGG + Intergenic
1026776344 7:73233399-73233421 CAACATGCATACCTGCAGCCGGG + Intergenic
1027017196 7:74786768-74786790 CAACATGCATACCTGCAGCCGGG + Intronic
1027070827 7:75159164-75159186 CAACATGCATACCTGCAGCCGGG - Intergenic
1027415767 7:77972934-77972956 CCACACTCCAACCTCCAGCCTGG - Intergenic
1031768803 7:125815789-125815811 CCACATTCATACCTTCAAACAGG - Intergenic
1031903184 7:127432082-127432104 CCACATTCTCTCCTCAAGCCAGG + Intergenic
1031927529 7:127652315-127652337 CCACATTGACACCTCCAGTCCGG + Exonic
1032238287 7:130142348-130142370 TCACACTCACAGCTGCAGCAAGG - Intergenic
1032442079 7:131949733-131949755 CCACAGAGACACCTGGAGCCTGG + Intergenic
1032477482 7:132222295-132222317 CCACACTAACACCTGCTGCATGG - Intronic
1033001554 7:137510725-137510747 ACACATTCAGTCATGCAGCCTGG + Intronic
1033139636 7:138813908-138813930 TCACCTTCACACCTGAGGCCAGG + Intronic
1034380179 7:150685339-150685361 CCTCATTGACACCAGCAGCAGGG - Intergenic
1035599887 8:891167-891189 CCTCAATCACACCTGTGGCCTGG - Intergenic
1036758891 8:11493183-11493205 CCACATTCACATCAGCTTCCAGG + Intergenic
1038270075 8:26067862-26067884 CCACAGTATCAACTGCAGCCTGG + Intergenic
1039572769 8:38600747-38600769 CCAGATCCACACCTGTACCCCGG + Intergenic
1040471103 8:47736785-47736807 CCACACACACACCTGGCGCCCGG + Intergenic
1044436848 8:92174513-92174535 CCAGGCTCACACCTGAAGCCAGG + Intergenic
1048027080 8:130596910-130596932 CCAATTTCACACCTGCTGCCGGG + Intergenic
1048204348 8:132403514-132403536 CAAGGTTCACACCTGCAGCCTGG - Intronic
1048602344 8:135931395-135931417 CCCCACACACACCTGCAGCTGGG + Intergenic
1049256664 8:141617764-141617786 GGACACACACACCTGCAGCCTGG - Intergenic
1049578389 8:143400054-143400076 CCACACTCACCCCCACAGCCAGG + Intergenic
1049988154 9:970989-971011 CCACCGTCATACCCGCAGCCGGG + Intergenic
1050491175 9:6189508-6189530 CCACAATAAGACCAGCAGCCAGG - Intergenic
1051603155 9:18894302-18894324 CCACTTTCACTACTCCAGCCTGG + Intronic
1054144093 9:61549832-61549854 CCACATCCACACAGGCAGACTGG + Intergenic
1056617497 9:88180786-88180808 CCACATGTACACCAGCAGCCTGG + Intergenic
1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG + Intergenic
1056898919 9:90580608-90580630 GGACAGTCACACCAGCAGCCTGG + Intergenic
1058766225 9:108185159-108185181 CAAGATGCATACCTGCAGCCTGG + Intergenic
1062161527 9:135083000-135083022 CCACATTCCCAGCTGGACCCTGG + Intronic
1185765635 X:2723742-2723764 CCACATTCCCACCTCCCACCTGG - Intronic
1186790317 X:12991010-12991032 CAACATTCACACTTGAAGGCGGG + Intergenic
1187226688 X:17379956-17379978 TCACATTCACATCTCCAGCCTGG - Intronic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1191108483 X:56787566-56787588 CCAGTTTCACACCTGCTGCTTGG - Intergenic
1191109313 X:56792857-56792879 CCAGTTTCACACCTGCTGCTTGG - Intergenic
1191626856 X:63279158-63279180 CTAAATTCACACCTGGAGACTGG + Intergenic
1193483785 X:82060437-82060459 GCACATTCACACAGGCAGCAGGG - Intergenic
1198447906 X:136737022-136737044 ACACATTCATACATGCAGCCTGG - Intronic
1200060488 X:153481667-153481689 CCACACCCACCCCTGCAGCAGGG + Intronic
1200086183 X:153607367-153607389 CCACATTCCCAGCTGAAGTCTGG - Intergenic