ID: 1107343043

View in Genome Browser
Species Human (GRCh38)
Location 13:39430434-39430456
Sequence CTGTGAGGAGTAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107343043 Original CRISPR CTGTGAGGAGTAAAGGAAGT AGG (reversed) Intronic
900276566 1:1833436-1833458 CTGTGAGGAATAAGGGGAGCAGG + Intronic
900967072 1:5966216-5966238 CAGTGAGGGGCAAAGGGAGTGGG + Intronic
901010285 1:6197436-6197458 TTGTGAGGAGTAAAAGGAGATGG - Intronic
901120572 1:6889481-6889503 ATGTGGGGAGTAAAGTAAGTGGG + Intronic
902606923 1:17573963-17573985 TGGTGAAGAGGAAAGGAAGTTGG + Intronic
902690245 1:18106624-18106646 CTGAGAGGAGTGTAGGGAGTGGG - Intergenic
903124897 1:21241114-21241136 CTGTGAGCAGTATATGCAGTAGG - Intronic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
904761342 1:32806610-32806632 CTCTGAAGAGGAAAGGAAGAGGG + Exonic
906980412 1:50622792-50622814 CTGTGAGGAGTAGGGGAATTTGG + Intronic
907813215 1:57893124-57893146 CTGTGAGGATTAAATAAAGCAGG - Intronic
908187435 1:61665949-61665971 CTGTGAAGAAGAAAAGAAGTTGG + Intergenic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
909051669 1:70774736-70774758 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
909149883 1:71988277-71988299 CTATGAAGAGTAAAGGAGGTTGG + Intronic
909855919 1:80531436-80531458 CTGTGTAGAGGAAAAGAAGTGGG - Intergenic
909966851 1:81923488-81923510 CTCTGAGCAGTAGAGCAAGTAGG - Intronic
910368374 1:86489966-86489988 CTCTTAGGAGAAAAGGAAGGAGG + Intronic
910503287 1:87919254-87919276 CTGTGGGGAGTAAGGAAGGTAGG + Intergenic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
911730258 1:101285107-101285129 TTATGAGGATTAAATGAAGTAGG - Intergenic
911804399 1:102187256-102187278 TTTTGAGAATTAAAGGAAGTTGG - Intergenic
913253057 1:116928288-116928310 CTGAAAGGAGTAAAGCAAGGAGG - Intronic
914459655 1:147871672-147871694 CTTTTAGGAGTGAAGGAAATGGG - Intergenic
916085344 1:161265032-161265054 CTGATAGGAGTGAAGGAAGTAGG + Intronic
916509403 1:165458099-165458121 CTGCCAGGACTAAAGGAGGTGGG + Intergenic
918225762 1:182481022-182481044 CTGTGAGGTGTAAAGTTAGGTGG - Intronic
919846677 1:201647299-201647321 CAGTTAGGAGGAAAGGAAGAAGG + Intronic
920006223 1:202835644-202835666 GTGGGAGGAGGAAATGAAGTGGG + Intergenic
920786830 1:209050371-209050393 CTGTGAGGCGCCATGGAAGTGGG - Intergenic
920827465 1:209435255-209435277 CAGTGGGGAGTAAGGGAATTTGG - Intergenic
922084302 1:222331271-222331293 TTGTGAGGATTAAATGAGGTAGG - Intergenic
922180071 1:223226543-223226565 GTGAGAGGAGTGAAGGAAATGGG - Intronic
922655252 1:227376601-227376623 CAGTGAGGAGGAGAAGAAGTTGG - Intergenic
922764076 1:228148638-228148660 CAGTGAGGAAGAAAGGGAGTTGG - Intronic
924501221 1:244639693-244639715 ATGGGAGGAGGAAATGAAGTTGG - Intronic
1063573781 10:7242467-7242489 CTTTGAGGAGTGAATGAATTAGG + Intronic
1065455603 10:25903597-25903619 CTGTGAGGTGGAAAGGAGCTTGG - Intergenic
1066179973 10:32951759-32951781 CTGTGAGGAGGAAAGAAGTTGGG + Intronic
1067191385 10:44071046-44071068 CTGTGAAGAGTAAAAGGATTGGG - Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067432702 10:46254413-46254435 CTGTGAGGAGGACAGGATGCAGG - Intergenic
1067486320 10:46653911-46653933 CTATGAGGATTAAATGAGGTTGG - Intergenic
1067608435 10:47687738-47687760 CTATGAGGATTAAATGAGGTTGG + Intergenic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1070353343 10:75614593-75614615 CTAGGAAGAGGAAAGGAAGTTGG - Intronic
1070477297 10:76842114-76842136 CTTTAACAAGTAAAGGAAGTGGG - Intergenic
1071160628 10:82741491-82741513 TAGTGAGGAATAAGGGAAGTGGG - Intronic
1071270760 10:84005186-84005208 ATGTGAGGGGAAAAGGAAGAGGG + Intergenic
1071624020 10:87149361-87149383 CTATGAGGATTAAATGAGGTTGG + Intronic
1071883901 10:89928977-89928999 CTCTTAGGAGTGAAGGAAGCAGG + Intergenic
1072444740 10:95489200-95489222 CTGAGTGGAGTAAAGGAACCAGG - Intronic
1072914167 10:99526998-99527020 AGGTGAGGAAGAAAGGAAGTGGG + Intergenic
1073288361 10:102401544-102401566 CTGTGAGGAGTCAGAGGAGTCGG - Intronic
1073821119 10:107265159-107265181 CTTTGGGGATTAAAGGAAGCAGG - Intergenic
1074612395 10:115034652-115034674 CTGTAAGGAGACAAGGAGGTGGG + Intergenic
1074705642 10:116127531-116127553 GGGTGTGGAGTACAGGAAGTTGG + Intronic
1074751097 10:116588073-116588095 CTGTGTGTTGTAATGGAAGTAGG - Intergenic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1076799491 10:132813991-132814013 CTGTGAGGATTCAAGGAGCTGGG + Intronic
1078397890 11:10998083-10998105 CTGGGAGGAGGAAGGGAGGTTGG - Intergenic
1078433773 11:11308029-11308051 CTGGGAGGATTGGAGGAAGTGGG - Intronic
1078561973 11:12380103-12380125 CTGTGAGGAATAGAGGATGTTGG - Intronic
1079142767 11:17823767-17823789 TTGTGGGGAATAAAGGAAGCTGG - Intronic
1079603928 11:22342669-22342691 ATGGGAGGAGTAAAGGGAGAGGG - Intronic
1080637477 11:34136683-34136705 ATTTGAGGAGTAAAGGAGGCAGG - Exonic
1081713640 11:45233686-45233708 CTGTCAGGAGGAGAGGATGTGGG + Intronic
1085430839 11:76445915-76445937 CTGAGAGGACTATGGGAAGTAGG + Intronic
1085557715 11:77440464-77440486 CTGTGAAGATTAAAGGATATAGG - Intronic
1085764756 11:79273118-79273140 CTCTGAGAGGTAAAGGAACTTGG - Intronic
1086161311 11:83725010-83725032 CTGTTAGGAGTGAAGCAGGTAGG + Intronic
1086914389 11:92511955-92511977 CTGTGAGGAGCACAAGAACTTGG + Intronic
1086998602 11:93389595-93389617 TTGTGAGGAATAAATGAAGTAGG - Intronic
1087069526 11:94063786-94063808 CTGTGTGGAGCAAAGGAGGTAGG - Intronic
1088725381 11:112629837-112629859 CTGTGATGAGGAAAGGGAGCAGG + Intergenic
1090120993 11:124028083-124028105 GAATGAGGAGTAAAGGAAGATGG + Intergenic
1092779671 12:11973908-11973930 CTGTGAGGAGGAAAGGAGCAGGG - Intergenic
1092965298 12:13635448-13635470 CTGGGAGGAGCAGAGGAAGATGG + Intronic
1093128125 12:15355029-15355051 TTTTGAGTAGTAAAGGAATTTGG + Intronic
1093184453 12:16003757-16003779 CAGTGAGGAGTTATGGAAGCTGG - Intronic
1093528827 12:20136425-20136447 CTGTGAAGTGTCACGGAAGTGGG + Intergenic
1095481259 12:42638420-42638442 GGGTCCGGAGTAAAGGAAGTAGG + Intergenic
1095835833 12:46637965-46637987 CGGTGAGGAGGAATGGAATTGGG - Intergenic
1096122186 12:49095220-49095242 ATGTGAGGAGAGATGGAAGTCGG - Intergenic
1096519231 12:52174779-52174801 CTGTGAGCAGGAAAGAAAGCTGG - Intronic
1097481408 12:60130408-60130430 TTGTGAGGATTAAATGAAATAGG + Intergenic
1098076656 12:66738737-66738759 CTGTGAGAAGGAATGGAAATGGG + Intronic
1098626424 12:72676682-72676704 CTTTGTGGAGTAAATGGAGTTGG + Intergenic
1099704268 12:86130000-86130022 CTCTGAGGAGTGATGAAAGTTGG + Intronic
1100481483 12:94983805-94983827 CTGTGAAGAATAAAGGAAGGAGG - Intronic
1100642423 12:96494669-96494691 CAGTTAGGAGTACAGGAGGTAGG + Intronic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1102212754 12:111138941-111138963 CTGGCAGGAGTAAGGGAAGCAGG - Intronic
1102654714 12:114472210-114472232 CTGTGAGTAGGAAAAGAAATTGG - Intergenic
1102799151 12:115716459-115716481 CTGTGAAGAATAAAGGAAGCAGG + Intergenic
1102897005 12:116606205-116606227 CTGTGAAGAGTAGAGAAACTTGG - Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1108080557 13:46730488-46730510 CTGTCAAGAGAAAAGAAAGTAGG - Intronic
1108889688 13:55239782-55239804 CTGGTATGAGTAAAGGAAGAGGG + Intergenic
1109061571 13:57628804-57628826 CTGAGATTAGTAAATGAAGTTGG + Intergenic
1112646029 13:101332765-101332787 ATGTGAGAAATAAAGGAAATAGG + Intronic
1112932771 13:104762400-104762422 CAGTCAGGAGTAAAGAATGTAGG - Intergenic
1113403021 13:110012282-110012304 CTATGAGGAGCAAGAGAAGTAGG + Intergenic
1113895460 13:113761278-113761300 CTCTGTGGAGTAGAGGAAATGGG + Intronic
1114053393 14:18943084-18943106 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1114109166 14:19458842-19458864 CTTTGAGGAGAAAAGCAAGATGG - Intergenic
1114502233 14:23179117-23179139 CTTTGAGGAGAAGATGAAGTAGG - Intronic
1114746598 14:25154966-25154988 CTGTGTGGAGTAATGGCAGTGGG + Intergenic
1114781155 14:25539537-25539559 CTGTGGGGAGTACAGGTGGTTGG - Intergenic
1115119561 14:29924797-29924819 CAGTGTGGAGTTAAGGAAGTGGG - Intronic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115385219 14:32789134-32789156 CTGTGAGGAGGAATGGATCTAGG - Intronic
1115408436 14:33045939-33045961 CAGTGACGTGTACAGGAAGTAGG - Intronic
1116028004 14:39537543-39537565 CAGTGAGGAGATATGGAAGTGGG - Intergenic
1116231979 14:42229267-42229289 CTGTAAGGAGCAGGGGAAGTGGG + Intergenic
1117306222 14:54476662-54476684 CTGTGAGAAGTAAAGATAGTTGG - Exonic
1118250830 14:64159328-64159350 CTGAGAGCAGTGAAGGGAGTTGG + Exonic
1119081303 14:71696884-71696906 ATGTGAGTAGCAAAGGAAGAAGG + Intronic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1125932261 15:43608918-43608940 CTGTGAAGATTAAATGAGGTAGG - Intronic
1125945357 15:43708390-43708412 CTGTGAAGATTAAATGAGGTAGG - Intergenic
1126175665 15:45733157-45733179 CTGTAAGAAGTAAGGCAAGTAGG + Intergenic
1127188428 15:56505460-56505482 CTGTGAGGGGCTATGGAAGTGGG - Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128354047 15:66911884-66911906 CTGTGAGGATTAAATGAGGTTGG + Intergenic
1128583838 15:68829939-68829961 CTGATAGGAGGAAAGGTAGTTGG - Intronic
1129465978 15:75724400-75724422 CTGTAAGGCTTCAAGGAAGTTGG - Intronic
1129686824 15:77690947-77690969 GCCTGAGGAGTACAGGAAGTAGG + Intronic
1131057188 15:89382317-89382339 CAGAGTGGAATAAAGGAAGTGGG + Intergenic
1131596351 15:93802142-93802164 CTGTGAGGTGTAATGGTAGGTGG + Intergenic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1132322482 15:100936119-100936141 GAGTGACGAGTAAAGGAAGGAGG + Intronic
1133729781 16:8569439-8569461 GGGTGAGGAGGAAATGAAGTCGG + Intergenic
1133941488 16:10312766-10312788 TGGTGAGGAATAAAGGAAGACGG - Intergenic
1135345870 16:21687967-21687989 CTGTGATGAGTTAAGAAGGTGGG - Intronic
1135404609 16:22189447-22189469 CTGAGAGGATTAAATGAGGTAGG + Intronic
1136043525 16:27598807-27598829 CTGTGAGGGGTAAGGGTAGCAGG + Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1143458037 17:7080341-7080363 CCGAGAAGAGGAAAGGAAGTAGG - Intergenic
1147111137 17:38262606-38262628 CTGAGAGTAATAAAGGAATTAGG - Intergenic
1147747276 17:42702523-42702545 CTGGGAGGGCTAAAGGACGTCGG + Exonic
1148418376 17:47525838-47525860 CTGAGAGTAATAAAGGAATTAGG + Intronic
1148966921 17:51443425-51443447 CTGTAAGGAGAAAAGGGAGGTGG + Intergenic
1150387330 17:64772763-64772785 CTGTGAGGCATGAAGGGAGTGGG - Intergenic
1150556268 17:66257428-66257450 TTGTGAGGATTAAAGGGAATAGG - Intergenic
1153251618 18:3128174-3128196 ATGTGAGGAATAAAGGAGGTTGG - Intronic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1155577083 18:27259634-27259656 CGGTGAGGAGGAATGGAATTTGG + Intergenic
1156350037 18:36295996-36296018 CTGTGAGGAGATGCGGAAGTTGG + Intergenic
1157335350 18:46733691-46733713 ATGTGAGCAGGACAGGAAGTGGG + Intronic
1157542904 18:48524838-48524860 CTGTGAGGAGGCAAGGAGGCAGG - Intergenic
1157671703 18:49535328-49535350 CTGTGACAAGTAAAGAATGTTGG + Intergenic
1157728320 18:49982356-49982378 TTCTCAAGAGTAAAGGAAGTAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159652564 18:70995565-70995587 CTGTGTGGAGTCTAGGAACTCGG + Intergenic
1160255873 18:77248964-77248986 CCTTGAGGAGTTAAGGAAGTAGG - Intergenic
1160479310 18:79224393-79224415 CTGTGGGGTGGAAAGCAAGTGGG + Intronic
1162660339 19:12163538-12163560 CTGTGGAGAGAAAAGGAACTGGG - Intronic
1163507582 19:17717440-17717462 CTGTGAGCAGTAATAGTAGTGGG - Intergenic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1166345942 19:42165835-42165857 CTGTGAGTAGTAAGTGAAGGTGG + Intronic
1166397248 19:42450581-42450603 TTGTCACCAGTAAAGGAAGTGGG - Intergenic
1166571957 19:43802646-43802668 CTGGGAGGGGTGAAGGAAGAAGG - Intronic
1167124537 19:47540104-47540126 CTGTGGGGAGTAAACGAGATTGG - Intronic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
926392201 2:12404848-12404870 CTGGGTGGAGTGAAGGATGTAGG - Intergenic
926571303 2:14533264-14533286 ATAGGAGGAGTAAAGGAAGTAGG - Intergenic
926769979 2:16362491-16362513 CTGTGAGGGCTAAATGAAATTGG - Intergenic
927493652 2:23537623-23537645 CTGCAGGGACTAAAGGAAGTAGG + Intronic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
928612158 2:33001185-33001207 CTTTCAGTAGTAAAGGAATTTGG - Intronic
929596046 2:43176716-43176738 CTGTGAGGATTAAATAAGGTAGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
933247117 2:79987971-79987993 CTGTGTGGTTTAAGGGAAGTTGG + Intronic
934606158 2:95696956-95696978 GTGTGAGGTGTATAGGAAGAAGG - Intergenic
936141644 2:109946945-109946967 CTGGGAGGAGTCAGTGAAGTTGG + Intergenic
936178332 2:110244893-110244915 CTGGGAGGAGTCAGTGAAGTTGG + Intergenic
936203046 2:110424539-110424561 CTGGGAGGAGTCAGTGAAGTTGG - Intronic
936946986 2:117940055-117940077 CTCTGAGCAGCAAAGGAAGGTGG + Intronic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937784041 2:125874280-125874302 CTGTGAGGAGTGCAGGGAGGAGG + Intergenic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
939976273 2:148720395-148720417 TTGTGAGGTGTCATGGAAGTGGG + Intronic
940634871 2:156286798-156286820 TTGTGAGGATTAAAAGAACTTGG - Intergenic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942225721 2:173814034-173814056 CTGTGAAGGATAAAGTAAGTTGG - Intergenic
943420486 2:187662165-187662187 TGGTGAGGAGTCATGGAAGTGGG + Intergenic
943463615 2:188200454-188200476 TGTTGAGGAGTGAAGGAAGTTGG - Intergenic
944991466 2:205241901-205241923 ATGTGAGTTATAAAGGAAGTTGG + Intronic
945052958 2:205842926-205842948 GTGTTAGGGGTAAAGGGAGTTGG - Intergenic
945472308 2:210241093-210241115 CTGTGAAGAGAAAAGAAAATAGG + Intergenic
945543526 2:211120320-211120342 CTGTGAGGAGAAAATGAAAGGGG + Intergenic
946536845 2:220639606-220639628 GTCTGAGGAGTCAAGGCAGTAGG - Intergenic
947508883 2:230732536-230732558 TTGTGAGGAGTACATGAAGATGG + Intronic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948393763 2:237630025-237630047 CTGTCAGAATTAAAGAAAGTGGG + Intronic
948856923 2:240734594-240734616 GTGTGAGGAGTCCAGGAAGCTGG + Intronic
1168765326 20:378450-378472 CTGTGAGGGGTGAAGAAAGGTGG - Intronic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1170792519 20:19519711-19519733 CTGTGCCAAGTAAAGGAAGAAGG + Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171475981 20:25409149-25409171 CTGTGGGGAGTCTAGGAAGGTGG + Intronic
1171509943 20:25673981-25674003 CTGGCAGGAGTAAAGCATGTTGG - Intergenic
1172777212 20:37414680-37414702 ATGTGTGGAGCAAAGGGAGTTGG - Intergenic
1172951735 20:38726862-38726884 TTGTGAGGCGAAAAGGAAATAGG - Intronic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174789519 20:53464444-53464466 CTGTGAGGAGGGAAGGAGCTTGG + Intronic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1176348812 21:5773837-5773859 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
1176355626 21:5894421-5894443 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
1176543133 21:8171907-8171929 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
1176562084 21:8354952-8354974 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1176909740 21:14550178-14550200 ATGGGAGGAGTTAAGGAAGTGGG + Intronic
1177368484 21:20170508-20170530 CTGTAAGGAGTTCAGGAAGGAGG - Intergenic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1179437253 21:41370279-41370301 CTGTGACGAGCAGAGGAAATGGG + Intronic
1179784231 21:43720390-43720412 CTGGGAGGAGGACAGGAAGAGGG + Intronic
1179902406 21:44401016-44401038 CCGTGAGGAGAAAGGGAAGGAGG - Intronic
1179927837 21:44547961-44547983 CTTTGAGGAATAAGGGAGGTGGG - Intronic
1180167492 21:46037593-46037615 CTGAGTGGAGAAAAGGAACTGGG - Intergenic
1180471862 22:15665459-15665481 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183659238 22:39208682-39208704 TTGTGAGGATTAAAGGAGCTAGG - Intergenic
1183813594 22:40279290-40279312 TTCTGGGTAGTAAAGGAAGTAGG + Intronic
1184617941 22:45650731-45650753 CAGTGGAGAGTAAAGGAAGCGGG + Intergenic
1203248003 22_KI270733v1_random:88145-88167 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
949492146 3:4599544-4599566 AGGTGAGGACCAAAGGAAGTAGG - Intronic
950462351 3:13132922-13132944 CTCTGCTGAGTACAGGAAGTAGG + Intergenic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
951709977 3:25577302-25577324 CTGTGAAAAGTAAAGAGAGTCGG + Intronic
953276123 3:41500448-41500470 CTGTGATGATTAAAGGGAGGAGG + Intronic
954427743 3:50452272-50452294 CTGTGAGGGGTGAAGGACGCAGG - Intronic
954603289 3:51889159-51889181 CTGTATGGAGAAAAGGAACTTGG - Intergenic
954743732 3:52774805-52774827 TTGTGAGCAGTAAATGAATTCGG + Intergenic
954765815 3:52915143-52915165 TTAGAAGGAGTAAAGGAAGTAGG - Intronic
954984554 3:54778207-54778229 CTGTGAGGAGAACAGCAAGGGGG + Intronic
955869089 3:63417810-63417832 CTGTGAGCAGTCTAGGAACTTGG - Intronic
956191246 3:66610380-66610402 CTTTGAGGGGGAAAGGAAGATGG - Intergenic
958612872 3:96449899-96449921 GTCTGAGGAGTACAGGAAGCTGG + Intergenic
959612663 3:108312734-108312756 TTGTAAGGAATCAAGGAAGTAGG - Intronic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961996109 3:131245113-131245135 CAGTGTGGAGTAACGGACGTTGG - Intronic
962371186 3:134822055-134822077 CTGAGATGAGTATAGGAGGTAGG + Intronic
962375764 3:134857548-134857570 CTGAGCAGGGTAAAGGAAGTTGG + Intronic
962442025 3:135429273-135429295 CTGTGAGAAGGAACGGTAGTGGG + Intergenic
964194567 3:154047700-154047722 CTGGGAGGAGCAGAGGAGGTAGG - Intergenic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
966454741 3:180102245-180102267 CCGTGAGGTGTCATGGAAGTGGG - Intergenic
967199645 3:187060698-187060720 ATGTGAGAAGTAAAGGGAGAGGG + Intronic
967365916 3:188686365-188686387 CTGTGGGGACTAACTGAAGTGGG - Intronic
967798765 3:193630155-193630177 CTGTGAGGAGACAAGCAAGTTGG - Intronic
969123956 4:4932087-4932109 CTTTGAGGAGTGAAGGAGGGAGG + Intergenic
971105836 4:23523891-23523913 CTGTGAGGTGTCATGGAAGTGGG - Intergenic
972245087 4:37237704-37237726 CTCAGGGGAGTAAAGTAAGTAGG - Intergenic
972271423 4:37513830-37513852 CTGTAGGGAGTAAAGGATGGAGG + Intronic
974184740 4:58431129-58431151 CAGTGAGGAGGAATGGAACTGGG + Intergenic
974199715 4:58622729-58622751 CAGTGAGGAGGAATGGAATTTGG - Intergenic
974996828 4:69171110-69171132 CTGTGAAGAGGAAAGGAACACGG + Intronic
975008234 4:69317681-69317703 CTGTGAGGAGAAAAGGAACATGG - Intronic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975523324 4:75323500-75323522 CCGGGAGGAGTAGAAGAAGTTGG + Intergenic
975998180 4:80340523-80340545 TTGTGAGGTGCAAGGGAAGTGGG - Intronic
977394222 4:96451156-96451178 CTGTGAGGTGCCATGGAAGTTGG + Intergenic
977514659 4:98006405-98006427 CTGTGAGAAGTGAAGGCACTAGG + Intronic
977839569 4:101686104-101686126 CTGTGAGGAGAGAAAAAAGTAGG + Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978025459 4:103867734-103867756 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
978072096 4:104486850-104486872 CTGTAATGAGTACAGGAAGGTGG - Intronic
978683935 4:111415959-111415981 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
980209389 4:129766211-129766233 CTGTCAAGAGTTAAGGAGGTGGG + Intergenic
980452866 4:132998065-132998087 ATGTGAGCAGGAAAGCAAGTGGG + Intergenic
980808932 4:137850859-137850881 TTGTGAGTAGAAAAGGAATTGGG - Intergenic
982266697 4:153544499-153544521 GTGTGAGGGGTAAGGGAAGAGGG - Intronic
982321069 4:154078022-154078044 CTGACAGGAGGAAAGGAAGTGGG - Intergenic
982357089 4:154482900-154482922 CTGTAAAGAGTAAAGGCAGCAGG + Intronic
983091000 4:163502400-163502422 TTGAGAGAAGTAAAGAAAGTGGG - Intronic
984132181 4:175891434-175891456 CTGGGAGGACTCAAGGAAGTGGG - Intronic
985552727 5:541623-541645 CTGTGAGGAGCAGGGGAAGGTGG - Intergenic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985905574 5:2832834-2832856 CTTTGAGGAGTGAAGCAAGAGGG - Intergenic
986260565 5:6142384-6142406 CTGTGAGGGGTAAGGGAAGCAGG + Intergenic
988408279 5:30852693-30852715 CTCTGAGAAGGAAAGGAGGTGGG - Intergenic
988424865 5:31052193-31052215 ATGTGTGGAGTAAAGGATGCTGG - Intergenic
989789608 5:45381532-45381554 ATGTGAGGAGTAAGGGACGAGGG - Intronic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
995428497 5:112049650-112049672 CAGTGAGGAGGAATGGAATTGGG - Intergenic
995760304 5:115555202-115555224 CTATGGGGAGTGGAGGAAGTAGG - Intergenic
996854912 5:127994992-127995014 CTGTGGGGAGTAAAGCAAAGGGG - Intergenic
996901812 5:128551592-128551614 CTGTGAGGTGTCATGGAAGTGGG - Intronic
998102411 5:139445352-139445374 CTATGAGGAGTAAGGGAAGTAGG + Intergenic
998400966 5:141849046-141849068 ATGTCTGGAGTTAAGGAAGTTGG - Intergenic
998437065 5:142119884-142119906 CTGTGATGATTAAAGGGACTTGG - Intronic
998461080 5:142310639-142310661 CAGTGAGGGGGAAATGAAGTTGG + Exonic
998562067 5:143180993-143181015 CAGTGATGAGTAAAGGAAGCTGG - Intronic
999613044 5:153391603-153391625 CTGTGATGAGTAAATGACTTGGG - Intergenic
999772408 5:154785580-154785602 CTGTGAGGAGCAGAGTAGGTAGG + Intronic
1000002215 5:157149802-157149824 CTGTAAGAAGTAAAGGAAAGAGG - Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1004815045 6:19303697-19303719 CTGTGAGGCGGAAAGGATCTAGG - Intergenic
1006043551 6:31273672-31273694 CTGTGAAAAGTCAAGGAATTGGG - Intronic
1006094766 6:31649043-31649065 CTTTAAGGAGAAAAGGAGGTAGG - Intronic
1006113352 6:31762071-31762093 GTGGGAGGAGTAAGGGGAGTGGG - Intronic
1006174311 6:32112728-32112750 GTGTGGGAAGTAAAGGGAGTGGG + Intronic
1007076156 6:39067673-39067695 ATGTGAGGAGGACAGGAATTTGG - Intronic
1007195319 6:40055527-40055549 CTGTGAGGTGCCATGGAAGTGGG - Intergenic
1009975888 6:70670162-70670184 TTTTGAGAAGTGAAGGAAGTGGG + Intronic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1010059986 6:71611319-71611341 CTGAGAGGAGGAAAGGGGGTCGG + Intergenic
1010128499 6:72463506-72463528 GGGTGAGGAGTAGAGGAGGTAGG + Intergenic
1011443505 6:87412419-87412441 GAGTGAGCAGTGAAGGAAGTGGG + Intronic
1012147214 6:95700179-95700201 CCTTGAGGAGTAAGGGATGTAGG - Intergenic
1013193718 6:107826645-107826667 CTGGGAGGAGGCAAGGAGGTTGG - Intergenic
1013968670 6:115987936-115987958 TTGTGAAAAGTAAAGTAAGTAGG - Intronic
1014124123 6:117758267-117758289 CTGTGAGGTGTCATGTAAGTGGG - Intergenic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1015365076 6:132388241-132388263 TTGTGAGGATTAAATGAAATAGG - Intronic
1015510398 6:134032632-134032654 GTATCAGTAGTAAAGGAAGTGGG - Intronic
1016706561 6:147115397-147115419 CCATGAGGAGTAAATGAATTAGG + Intergenic
1017315484 6:153026516-153026538 CTGTGAGGAATGAAGAAAGAGGG - Exonic
1017819793 6:158041074-158041096 CTGTGAGGGGTAAATGAGGGGGG - Intronic
1018644812 6:165938019-165938041 CTTTGTAGAGGAAAGGAAGTGGG - Intronic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1020343437 7:7137498-7137520 CTCAGGAGAGTAAAGGAAGTGGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1023121904 7:36918086-36918108 CTCTGAGGAGGGAAGGAAATGGG + Intronic
1025051555 7:55738214-55738236 GTGGCAGGAGTAAAGGAAGAAGG - Intergenic
1026431469 7:70351617-70351639 CTGTTAGGAGGAATGTAAGTTGG - Intronic
1026586438 7:71659847-71659869 CTGAGCTGAGTAGAGGAAGTGGG - Intronic
1026642294 7:72138536-72138558 CTGTGAGGAGCAAAGGAGACGGG + Intronic
1030439656 7:109572290-109572312 ATGTGAGGAGTAAATGAATCAGG + Intergenic
1030773279 7:113501370-113501392 GTGTAAGGAATAAAGGAAGAAGG - Intergenic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1031923468 7:127617962-127617984 CTGTGTGGAGGAAATGAGGTGGG + Intergenic
1031991853 7:128203560-128203582 CTGTTAGGAGGAAAGGGAGGAGG - Intergenic
1033440424 7:141373486-141373508 CTGGAAGGAGTGAAGGAAGCAGG + Intronic
1034364512 7:150534628-150534650 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
1034453473 7:151150643-151150665 CTGTGAGGGGGAAGGGAACTTGG - Intronic
1035939279 8:3877619-3877641 CTGTAAGGAGTAGATGAACTGGG - Intronic
1037339574 8:17829993-17830015 ATGTGCTGAGTAAAGGAAGCTGG + Intergenic
1038375076 8:27032191-27032213 CTGGGAGGTGGAAAGGAACTTGG + Intergenic
1039074027 8:33672613-33672635 CTGAGGAGAGTAAAGGAAATTGG + Intergenic
1041700960 8:60788530-60788552 CTGTTAGCAGGAAAGGAAGAGGG - Intronic
1042467619 8:69146037-69146059 TTGTGGTGACTAAAGGAAGTGGG + Intergenic
1043191251 8:77225548-77225570 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
1047327510 8:123853922-123853944 CTCTGAGGAGCAAAGGATGCAGG + Intronic
1048546694 8:135394240-135394262 GAGAGAGGAGTAAAGGAAGATGG + Intergenic
1051502222 9:17790390-17790412 CAGTCAGGAGTAAGGCAAGTAGG - Intronic
1053415969 9:37946931-37946953 CTGTGAGAGGTAAAGGAAGCAGG - Intronic
1054846764 9:69806770-69806792 CTGTGAGGGGGAAATGAGGTGGG - Intergenic
1055409513 9:76013961-76013983 CTTTGAAGAAAAAAGGAAGTGGG + Intronic
1058194562 9:101956689-101956711 CTCTGAGGAGGCAATGAAGTGGG + Intergenic
1058208848 9:102142076-102142098 CTTTAAGGAGGAAAGGAAGCCGG - Intergenic
1058794321 9:108483408-108483430 CCGTGAGGAGTTAATGAAGGTGG + Intergenic
1058794329 9:108483457-108483479 CTGTGAGGAGTTAATGAAGGTGG + Intergenic
1059209423 9:112498891-112498913 CTGGGAAGAGTAAAGGGAGAGGG - Intronic
1059749238 9:117232329-117232351 TGGGGAGGAGTAAAGGATGTTGG - Intronic
1059874828 9:118622820-118622842 CTGTGATGAGTCAAGAAGGTAGG - Intergenic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061562792 9:131417241-131417263 CTGTGAGGAGCAGCAGAAGTGGG + Intronic
1061788347 9:133044489-133044511 CCATGGGGAGCAAAGGAAGTAGG - Intronic
1203464403 Un_GL000220v1:71376-71398 CTGTGAGGCGTCATGGAAGTGGG - Intergenic
1186119464 X:6343728-6343750 TTGTGAACAGTGAAGGAAGTTGG + Intergenic
1186502997 X:10066799-10066821 GTGGGAGGAGACAAGGAAGTCGG + Intronic
1186731307 X:12413208-12413230 ATCTGAGGAGCAAAGGAACTGGG - Intronic
1187195466 X:17079324-17079346 CTGCTAGGGGTCAAGGAAGTCGG - Intronic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1187321747 X:18245583-18245605 GGTTGAGGAGTGAAGGAAGTGGG - Intronic
1187744244 X:22390877-22390899 CTGTGAGGATTTAAAGAAATAGG - Intergenic
1187793674 X:22978356-22978378 CTTTGAGAATTAAGGGAAGTCGG - Intergenic
1188043042 X:25392715-25392737 CTTTGAGAAGAAAAGGATGTGGG + Intergenic
1188972629 X:36636332-36636354 CTGTAAGGAGTGAAGGAAGCAGG - Intergenic
1189273147 X:39765943-39765965 CGGTGTGGAGTAAGGGGAGTGGG - Intergenic
1189357927 X:40325545-40325567 CTGTGAGGAAAAAAAGAAATGGG - Intergenic
1189690861 X:43615607-43615629 CTGTGGATAGTAAAGGAAGCCGG + Intergenic
1191155040 X:57265346-57265368 CTGTGAGGTGCAACGGAAGTGGG - Intergenic
1191780220 X:64856562-64856584 CTGTTAGGGGAAAAAGAAGTAGG - Intergenic
1191876886 X:65806764-65806786 CTGTGAGGTGCCAAGGAAGTGGG - Intergenic
1192362931 X:70450498-70450520 CTGTGAGGAGCAGAGGCAGGAGG - Intronic
1193061856 X:77215277-77215299 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
1193295799 X:79829971-79829993 CTGTAAGGAGTAATGGAATTAGG + Intergenic
1193704801 X:84808527-84808549 CTGTGAAGAGGAAGGGAACTAGG + Intergenic
1193805042 X:85985065-85985087 CTGTGAGGTGCCATGGAAGTGGG - Intronic
1194635755 X:96343228-96343250 CTGTGAGGTGCCATGGAAGTGGG + Intergenic
1194867368 X:99085783-99085805 CTGTGAGGTTTCATGGAAGTGGG - Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195071617 X:101286396-101286418 CTTTTAAGAGGAAAGGAAGTAGG - Intronic
1195346206 X:103953447-103953469 CTGTGAGGTGTTGTGGAAGTGGG - Intronic
1196581950 X:117390571-117390593 CTGTGAGGTGTGGTGGAAGTGGG - Intergenic
1197122042 X:122905419-122905441 CTGTGAGATGTCATGGAAGTAGG - Intergenic
1197122292 X:122906666-122906688 CAGTGAGGAGTAACGGGATTGGG - Intergenic
1197391456 X:125871710-125871732 CTGTGATGAGTAATGGGGGTGGG - Intergenic
1197898991 X:131348189-131348211 CTGTGAGGAATTAAGCAACTAGG - Intronic
1198084904 X:133273057-133273079 CTTTTAGGTCTAAAGGAAGTTGG + Intergenic
1198424646 X:136504575-136504597 CAGCGAGTAGTAAAGGAAGATGG + Intronic
1198995709 X:142571499-142571521 CTGTGAGGTGCCACGGAAGTGGG - Intergenic
1200080900 X:153575847-153575869 CTGTGAGGAGTAAAGGACTGTGG + Intronic
1200336226 X:155353938-155353960 CTGTGAGGTGCAGTGGAAGTGGG - Intergenic
1200350244 X:155487289-155487311 CTGTGAGGTGCAGTGGAAGTGGG + Intergenic