ID: 1107348880

View in Genome Browser
Species Human (GRCh38)
Location 13:39493056-39493078
Sequence ACTCCTGCTGTTGGTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107348875_1107348880 12 Left 1107348875 13:39493021-39493043 CCATCATGTGAATATGCCCTAAT 0: 1
1: 0
2: 3
3: 37
4: 262
Right 1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG 0: 1
1: 0
2: 2
3: 16
4: 175
1107348877_1107348880 -5 Left 1107348877 13:39493038-39493060 CCTAATTTCTATAACCATACTCC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG 0: 1
1: 0
2: 2
3: 16
4: 175
1107348876_1107348880 -4 Left 1107348876 13:39493037-39493059 CCCTAATTTCTATAACCATACTC 0: 1
1: 0
2: 1
3: 21
4: 280
Right 1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG 0: 1
1: 0
2: 2
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107348880 Original CRISPR ACTCCTGCTGTTGGTCATTC AGG Intronic
901794753 1:11673712-11673734 AATGCTGCTGTTGGTGACTCGGG - Exonic
902943188 1:19815007-19815029 GCCCCTGCTGGGGGTCATTCTGG - Exonic
904547280 1:31285271-31285293 ACTCTGTCTGTTGCTCATTCTGG + Intronic
905908457 1:41637244-41637266 TTTCCTGCTGATGGTCATTAAGG - Intronic
906464835 1:46068739-46068761 ACTCTCCCTTTTGGTCATTCAGG - Intronic
907391817 1:54163142-54163164 CCTCAGGCTGCTGGTCATTCCGG + Intronic
908986041 1:70023254-70023276 ATGCCAGCTGTGGGTCATTCTGG - Exonic
915591486 1:156873603-156873625 CCTCCTGCTGTTGCTCTTTCTGG + Intronic
921307781 1:213814294-213814316 ACTGCTCCCGTTGGTCATTTAGG - Intergenic
921478861 1:215640636-215640658 ACTCCTTCAGTTGGCCGTTCAGG + Exonic
921730438 1:218572209-218572231 ATTCCTGCTGTAGGTCATTAGGG - Intergenic
923183285 1:231544281-231544303 ACTCTTGCCTTTAGTCATTCAGG - Intronic
1064769912 10:18712486-18712508 AGACCTGCTGTTGGTCATCCTGG + Intergenic
1067142150 10:43667110-43667132 TCCCCTGCTGTTGGACATTTAGG + Intergenic
1067457249 10:46427835-46427857 CCTCCTGCAGTTGGTCATTCAGG - Intergenic
1067629953 10:47956803-47956825 CCTCCTGCAGTTGGTCATTCAGG + Intergenic
1070363606 10:75714644-75714666 TCTCATGCTGTTGGGCATTTAGG + Intronic
1070659977 10:78298598-78298620 CTGCCTGCTTTTGGTCATTCTGG + Intergenic
1074616076 10:115069451-115069473 ACTCATGCTGTTTTTCATTGGGG + Intergenic
1074834718 10:117279078-117279100 ATGCCTGCTGTTGGTCCCTCGGG + Exonic
1075662887 10:124210342-124210364 ACACCTGCTCTTGGTCTTTTTGG - Intergenic
1075682358 10:124341792-124341814 AACCCTGCTGCTGGCCATTCTGG - Intergenic
1076079670 10:127567659-127567681 GCTACTGCTGATGGTGATTCAGG - Intergenic
1077084641 11:742897-742919 TCTCCTGCTGATGGACATTTGGG + Intergenic
1080669759 11:34365258-34365280 TCTCCTGCTGTTGCCCAGTCTGG - Intergenic
1083901549 11:65645939-65645961 ACACCTGCTGCTGGTTATTAGGG - Exonic
1086437739 11:86799213-86799235 ACTCCCTCTGTAGCTCATTCTGG - Intronic
1086750109 11:90482275-90482297 ACCCCTGCTTTTAGTCAGTCAGG + Intergenic
1087483497 11:98732207-98732229 ACTCCTGTTGTTGGTCAGGCTGG + Intergenic
1087846800 11:102982784-102982806 ACTCATGCTGTTGCCCATGCTGG - Intergenic
1088625368 11:111726596-111726618 ACTGGTTCTGTTGGTCAGTCAGG + Exonic
1091273179 11:134332106-134332128 ACTCCTGCTGCTGGTCGTCTTGG + Exonic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1094066746 12:26369783-26369805 AATCATGCAGTTGGTCTTTCTGG - Intronic
1098980765 12:76953196-76953218 ACTCCTGGTCTTTGTCATGCTGG + Intergenic
1100208015 12:92372344-92372366 ACTCCTGTTGATGGACATTTGGG + Intergenic
1101346330 12:103889545-103889567 ACTCCAGCTTTTGGACATGCTGG - Intergenic
1101926842 12:108978865-108978887 ACTCCTGTTGATGGACATTCTGG - Intronic
1102567887 12:113808964-113808986 TCTCCTGCTCTTGGACCTTCAGG + Intergenic
1103594321 12:122014485-122014507 ACTCCTGCTGCTGTTCCTCCGGG - Intergenic
1103956592 12:124580665-124580687 ACTCCTGCTCTGGGTAACTCAGG - Intergenic
1104063905 12:125290698-125290720 CCTCCTGCTGATGGGCATTTAGG + Intronic
1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG + Intronic
1108695404 13:52898483-52898505 TCTACTGCTGATGGACATTCAGG + Intergenic
1110031199 13:70616237-70616259 ACTCCTGCTTTTAGTTGTTCAGG - Intergenic
1110542841 13:76725309-76725331 TCTACTGCTGTTTGTGATTCAGG - Intergenic
1110925874 13:81150779-81150801 AGTCCTGCTGTTGTTAACTCTGG - Intergenic
1111376262 13:87382085-87382107 TCTCATGGTATTGGTCATTCTGG - Intergenic
1113118297 13:106897914-106897936 ACTTCTGTTGATGGTCATTTGGG + Intergenic
1113170459 13:107496289-107496311 AGACCAGCTGTTTGTCATTCAGG - Intronic
1113933788 13:113982473-113982495 ACTCCTGCTGAAGGCCATTCTGG + Intronic
1117341775 14:54797958-54797980 ATTCCTGCTTTTAGTCCTTCTGG - Intergenic
1117619752 14:57573305-57573327 ACTCCTGCTGTTTTTCATTAAGG - Intronic
1120275700 14:82370252-82370274 AATATTGCTGTTGGTTATTCAGG - Intergenic
1122522587 14:102355571-102355593 ACTCCTCCTGTGCGTCATCCGGG - Intronic
1123014336 14:105366634-105366656 TCTCCTGCTGCTGGAGATTCCGG + Intronic
1125115241 15:36083258-36083280 TCTTCAGTTGTTGGTCATTCAGG - Intergenic
1127049121 15:55061955-55061977 ACTCATGCTCTGGGTCATTTAGG - Intergenic
1127855792 15:62952875-62952897 TCTCCTGCTGATGGACATTTTGG - Intergenic
1128204674 15:65840169-65840191 TCTCCTGTTGTTGGCCATTTCGG + Intronic
1130362427 15:83202901-83202923 TCTCCTGCTGATGGACATTTGGG + Intronic
1132769128 16:1551317-1551339 CCTCCTGCTGCTGATCCTTCGGG - Intronic
1132839414 16:1971784-1971806 ACTCCTGCTTTTCGGCGTTCTGG - Intergenic
1133535845 16:6701699-6701721 TCTACTGCTGATGGGCATTCAGG - Intronic
1134488677 16:14679119-14679141 ACTCCTGCTTTTTGTTATTGGGG + Intronic
1135148678 16:19986250-19986272 GCTCCAGCTGTTGGCCCTTCAGG + Intergenic
1136188950 16:28604182-28604204 ACTCCTGCCATTGTTCACTCTGG - Intergenic
1136630880 16:31488632-31488654 ACTCATGCTGGCGGTCATGCTGG + Exonic
1138494580 16:57400008-57400030 ACTCCTGGTTTTAGTCAATCAGG - Intergenic
1139195932 16:64918526-64918548 ACTCCAGCTGTCAGTCATCCTGG - Intergenic
1141326194 16:83061568-83061590 TCCTCTGCTGCTGGTCATTCAGG - Intronic
1141473833 16:84258556-84258578 AATCCTGCTGCTGTTCACTCTGG + Intergenic
1141705988 16:85664887-85664909 ACACCTGCTTTTGGTTTTTCGGG + Intronic
1141811908 16:86381583-86381605 TCTCCTCCAGGTGGTCATTCAGG + Intergenic
1144130169 17:12239094-12239116 AATCTTGCTGTTGTTCACTCTGG - Intergenic
1146491357 17:33285219-33285241 CATCCTGATGTTGGTCATTTTGG + Intronic
1148137405 17:45303090-45303112 ACTTCTGCTGTTTTTCACTCTGG - Intronic
1148637869 17:49162988-49163010 ACTTCTGATTTTTGTCATTCTGG + Intronic
1150149135 17:62794527-62794549 GCTCCTGCTCTCAGTCATTCAGG + Intronic
1150806686 17:68325027-68325049 ACCCCTGCTGTAGGTGATCCAGG - Intronic
1152594450 17:81231654-81231676 ACTCCTGCTGACAGTCACTCAGG + Exonic
1155872650 18:31046469-31046491 AGTCCTACTGTCAGTCATTCTGG - Intergenic
1157191237 18:45583470-45583492 AGTCCTGCTTTTAGGCATTCAGG - Intronic
1158403406 18:57140866-57140888 AAACCTCCTGTTTGTCATTCAGG - Intergenic
1158775150 18:60569310-60569332 ACTCGTGCTGTTGTAAATTCAGG + Intergenic
1159474690 18:68905702-68905724 ACTTCTGCTTTCTGTCATTCTGG + Intronic
1160949066 19:1657114-1657136 CCTCCTGCTGTAGGGCATTCAGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166235213 19:41450802-41450824 ATTCCTGCTGATGGGCATTTGGG - Intergenic
1167255572 19:48426125-48426147 TCTACTGCTGGTGGACATTCAGG + Intronic
1168470591 19:56637741-56637763 ATTCAGGCTGTTGGTTATTCTGG - Intergenic
925930868 2:8706769-8706791 ACTGCTGCTGCTTTTCATTCTGG - Intergenic
926210129 2:10863189-10863211 ACCCCTGCTTCTGGTCCTTCAGG + Intergenic
927126279 2:20014433-20014455 TCTCCTGCTCTTGGGCCTTCAGG - Intergenic
930655341 2:54002229-54002251 ACTCCTGCTGTATAACATTCTGG - Intronic
930778250 2:55196672-55196694 GCTACTGCTGCTGGTCATTCAGG - Intronic
934527339 2:95059892-95059914 ACTCCTGCTTCTGGGCATCCTGG + Intergenic
934651885 2:96097300-96097322 CTTCTTGCTTTTGGTCATTCTGG - Intergenic
934944087 2:98524085-98524107 CCTCCTACTGCTGGACATTCAGG + Intronic
936889403 2:117351417-117351439 GCTCCTTATGTTGGTCCTTCAGG - Intergenic
939332506 2:140782917-140782939 ACTCCTGCTGTGTGACCTTCAGG - Intronic
940187933 2:151007478-151007500 CCTCCAGCTGTTAGTCCTTCAGG + Intronic
941479533 2:165988938-165988960 ACACCTGCTGCTTGTAATTCTGG + Intergenic
942069409 2:172302546-172302568 TCTCCAGCTGATGGACATTCAGG + Intergenic
942124863 2:172813810-172813832 CCTCCTGCTGGTGGACATTTGGG - Intronic
942136623 2:172932086-172932108 GCTCCCTCTGGTGGTCATTCCGG + Intronic
942397072 2:175561520-175561542 TCTCATGCTCATGGTCATTCTGG + Intergenic
942782706 2:179664620-179664642 TCTTCTGCTGTTGGACATTTAGG - Intronic
943791067 2:191933244-191933266 ACTCCTGCTGTTGGCTACTGTGG + Intergenic
945379005 2:209116727-209116749 ACTCCTGCTTTTATTCATTTTGG + Intergenic
945911619 2:215656454-215656476 TCTCCTGTTGATGGACATTCAGG + Intergenic
1169042956 20:2510821-2510843 ACCCCTGATTTTGGTCAGTCAGG - Intronic
1170084798 20:12516675-12516697 ACTCCTGTGGTTGGTCACTCTGG - Intergenic
1171498446 20:25574610-25574632 GCTCCTCCTGTTGGACCTTCTGG + Intronic
1172507457 20:35473996-35474018 CCTCCTGCTGTTCCTCCTTCTGG - Exonic
1173699048 20:45050387-45050409 TCTCCAGCTGATGGTCATTTAGG + Intronic
1175045488 20:56100957-56100979 ACCCCTGATGTTGGACATTTAGG - Intergenic
1176075104 20:63244790-63244812 GCTCATGCTGTTGGTGTTTCTGG - Intronic
1176585419 21:8580075-8580097 ACTCCCGCTGCAGGTCACTCTGG - Intergenic
1179243203 21:39609734-39609756 TCCCCTGCTGTTGATCCTTCTGG - Intronic
1180268227 22:10556974-10556996 ACTCCCGCTGCAGGTCACTCTGG - Intergenic
1181018831 22:20087619-20087641 CCTCCAGCTGATGGTCATGCTGG - Intronic
1184460946 22:44637503-44637525 CCTACTGCCCTTGGTCATTCTGG - Intergenic
950312581 3:11971745-11971767 TCTCCTACTGTTGGTCTTTTAGG + Intergenic
950515015 3:13459470-13459492 TCTCTTGGTGTTGGTCATTCTGG - Intergenic
952923835 3:38307399-38307421 ACTCCTCCTCATGGGCATTCAGG + Intronic
953819542 3:46193532-46193554 ACTTCTGCTTTTGGTCATGATGG + Intronic
955691049 3:61591119-61591141 TCTCCTGCTGATGGCCATTAAGG + Intronic
955875315 3:63483227-63483249 CTTCCTGCTGATGGACATTCAGG - Intronic
956733614 3:72218689-72218711 ACTCCTTATGGGGGTCATTCTGG - Intergenic
957665144 3:83217677-83217699 AATCCTGCTGCTGCTCACTCTGG - Intergenic
960656884 3:120014578-120014600 TATCCTGCTGTTGATCATTAGGG - Intronic
961454757 3:127018395-127018417 TCTCCTGCTGCTGGTCATCGTGG + Exonic
962282762 3:134064837-134064859 ACTCCAGCTTTTGGTTACTCAGG - Intergenic
966759228 3:183401823-183401845 TCTCCTACTGATGGACATTCAGG + Intronic
971558739 4:28047265-28047287 AGTATTGCTGTTGGTTATTCAGG + Intergenic
975832062 4:78379808-78379830 CCTCCTGGTCTTGGACATTCAGG - Exonic
977102668 4:92837109-92837131 ACTCCTAATTTTAGTCATTCAGG - Intronic
977959713 4:103072005-103072027 ACCACTGCTATTGGTGATTCTGG - Intronic
979206314 4:118042467-118042489 ATTACTGCTGTTCATCATTCTGG + Intronic
980656464 4:135793653-135793675 ACTCCTGCTGTTCAGCAATCAGG + Intergenic
980916624 4:139039388-139039410 CCACTTGGTGTTGGTCATTCTGG + Intronic
981311554 4:143302729-143302751 TCTCTTCCTGTTGGTCATACAGG - Intergenic
983143266 4:164179978-164180000 ACTTCTGATGTTGGACATTTGGG + Intronic
983421405 4:167522729-167522751 TGTTTTGCTGTTGGTCATTCTGG + Intergenic
985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG + Intronic
992970526 5:82052107-82052129 CTTCCTGCAGTTGATCATTCTGG + Intronic
994616190 5:102107462-102107484 AATATTGCTGCTGGTCATTCAGG + Intergenic
995963190 5:117870763-117870785 ACTCCTAATGTTGTCCATTCAGG + Intergenic
999598858 5:153237714-153237736 ACTGCTGCTTTTGATAATTCAGG + Intergenic
1000359734 5:160435910-160435932 CCTCCTTCTTTTGGTCTTTCAGG - Intergenic
1000670917 5:164062053-164062075 ATTCCTGCTGGTGGTCCTTAGGG - Intergenic
1003908444 6:10722866-10722888 TCTCCTGCTTTTGGCCACTCAGG + Intergenic
1006746655 6:36347382-36347404 ACCCCTTCTGTGGGTCAGTCAGG - Intergenic
1011505123 6:88033375-88033397 ACTCCAGCTCTTTGGCATTCTGG + Intergenic
1019865914 7:3709846-3709868 CCTCCTGCTGTTTGTCATCAAGG + Intronic
1020426859 7:8077124-8077146 CTTCTTGCTGTTGGTCATGCTGG + Intronic
1021387209 7:20045707-20045729 TCTCCTTCAGTTGGTCATTTAGG - Intergenic
1028910226 7:96199566-96199588 ACTCCTGCTCTTGGACCTTCTGG - Intronic
1030718202 7:112835878-112835900 TCTACTGCTGTTGGGCATTTAGG + Intronic
1031862283 7:126994318-126994340 AGTATTGCTGTTGGTGATTCAGG - Intronic
1032383204 7:131504644-131504666 GCTGCTCCTGGTGGTCATTCTGG + Intronic
1035420008 7:158719708-158719730 TCCCCTCCTGTTGGTCATTTGGG - Intergenic
1038044483 8:23754563-23754585 ACTCTTGCTATTGGACATTCTGG + Intergenic
1038382242 8:27106832-27106854 ATTCCAGCTGTAGGGCATTCTGG - Intergenic
1039579723 8:38654578-38654600 ACTGCTTCCTTTGGTCATTCAGG - Intergenic
1043507436 8:80916190-80916212 ACTCCTGCTGTGGGTCCTGAGGG + Intergenic
1045301195 8:100911660-100911682 ACTCCTGCTGGAGGTCAGTCAGG + Intergenic
1047593410 8:126351411-126351433 ACTCCTCCATATGGTCATTCAGG + Intergenic
1047788075 8:128173774-128173796 ACTCATGCAATTTGTCATTCAGG - Intergenic
1047794672 8:128242411-128242433 CCTCCTGCTTCTGGTTATTCAGG + Intergenic
1048260246 8:132939020-132939042 ACTCCTGCTGTTGCCCAGGCTGG - Intronic
1050157124 9:2679433-2679455 ACTCCTTCTATTGGTCCTTTTGG + Intergenic
1051993922 9:23190360-23190382 ACTCCTGCTTTTGCTTTTTCTGG - Intergenic
1052226313 9:26092411-26092433 TCTCTTGATGTTGGTCATTCTGG + Intergenic
1052763881 9:32620560-32620582 TCTCCTGATGTTGGTCAGGCTGG - Intergenic
1053014624 9:34654807-34654829 AGTCCAGCTGTTGGGAATTCTGG - Intronic
1053474671 9:38373482-38373504 ACTCCTGTTGCTGGCCATTTAGG - Intergenic
1053812801 9:41871867-41871889 TCAACTGCTGTTGGTCATTTAGG - Intergenic
1054617794 9:67315572-67315594 TCAACTGCTGTTGGTCATTTAGG + Intergenic
1054766480 9:69046671-69046693 TCCCCTACTGTTGGACATTCAGG + Intronic
1054982573 9:71223382-71223404 ACTATTGCTGCTGGTTATTCAGG - Intronic
1055778832 9:79796752-79796774 ACTTCTGCTTCTGGTCTTTCTGG + Intergenic
1056630014 9:88285682-88285704 TCTCCTTCTCTTGGTCATGCTGG - Intergenic
1058016490 9:100037820-100037842 TCTCTTGCTGCTGGTTATTCAGG - Intronic
1058447477 9:105066625-105066647 ACTCCTCCTGTTTGTGTTTCTGG - Intergenic
1060084142 9:120681195-120681217 GCTACTGCTGCTGGTTATTCAGG + Intronic
1203615320 Un_KI270749v1:57598-57620 ACTCCCGCTGCAGGTCACTCTGG - Intergenic
1188513265 X:30959165-30959187 TCTCTTGCTGGTGGTCATTTGGG - Intronic
1191682141 X:63851977-63851999 ACTCCTGTTATTGGTCACTGAGG + Intergenic
1197576581 X:128219455-128219477 TCTCTTGGTGTTGGTTATTCTGG - Intergenic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic
1200860139 Y:7982717-7982739 TCCCCTGCTGTTGGTAGTTCTGG - Intergenic
1202074639 Y:21025943-21025965 ACTCCTGTTGTTGGACCATCTGG + Intergenic