ID: 1107349772

View in Genome Browser
Species Human (GRCh38)
Location 13:39501734-39501756
Sequence CCATGACCACACTAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107349772_1107349777 28 Left 1107349772 13:39501734-39501756 CCCTGCTCTTAGTGTGGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1107349777 13:39501785-39501807 TCAAAAGCTTGACAAGAGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 267
1107349772_1107349776 24 Left 1107349772 13:39501734-39501756 CCCTGCTCTTAGTGTGGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1107349776 13:39501781-39501803 GTGTTCAAAAGCTTGACAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107349772 Original CRISPR CCATGACCACACTAAGAGCA GGG (reversed) Intronic
900110464 1:1003313-1003335 CCACCCCCACACTCAGAGCAAGG - Intergenic
900530875 1:3152633-3152655 CCATGAGGTCTCTAAGAGCAAGG + Intronic
900560697 1:3304587-3304609 GCATGTCCACACGAGGAGCACGG + Intronic
900869752 1:5293581-5293603 CCATGTCCTCCCTCAGAGCAAGG + Intergenic
904326717 1:29731304-29731326 CCAGGACCACACTGAGAAGAGGG - Intergenic
906176063 1:43773714-43773736 CCATTATCACACTAAGACAATGG + Intronic
910510550 1:87999347-87999369 ACTTGGCCACACTAAGTGCAGGG + Intergenic
910768922 1:90811139-90811161 CAATGATCACCCTAAGAGAATGG + Intergenic
911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG + Intronic
912261790 1:108118214-108118236 TCATGAACACAGCAAGAGCAAGG + Intergenic
916119364 1:161513793-161513815 CCATAACCAGACTCAAAGCAAGG - Intronic
916129126 1:161595451-161595473 CCATAACCAGACTCAAAGCAAGG - Intronic
918531022 1:185523255-185523277 CCACTACCACAAGAAGAGCATGG + Intergenic
1063318875 10:5033705-5033727 CTATGAAAACACTATGAGCAAGG + Intronic
1065699595 10:28411820-28411842 CCATGACATCATTTAGAGCAGGG - Intergenic
1067244420 10:44525338-44525360 CAATGATCACGCCAAGAGCAAGG - Intergenic
1069554636 10:69389727-69389749 TGCTGACCACACTTAGAGCATGG + Intronic
1070105337 10:73425979-73426001 CCATGACCACACGGAGTCCAAGG + Exonic
1070595902 10:77833058-77833080 CCCTCACCACACTAACAGCTAGG + Intronic
1071488732 10:86121650-86121672 CCATGACCACAATAATACCAGGG + Intronic
1073920523 10:108452976-108452998 CCTGGACCACACTAAGTGCATGG - Intergenic
1073929125 10:108554422-108554444 TCATTACCACAAGAAGAGCATGG - Intergenic
1074031910 10:109697332-109697354 CCATGCCCCCACTGACAGCATGG + Intergenic
1075043695 10:119128848-119128870 CGAGAACCACACTAAGAGGATGG + Intronic
1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG + Intergenic
1077760018 11:5084737-5084759 CCATCACCACTCCAAGACCATGG - Intergenic
1078872579 11:15362817-15362839 CCATCATCATACTAAGATCAGGG + Intergenic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1084851335 11:71943605-71943627 CCATGAGCAACCTGAGAGCAAGG - Intronic
1086020666 11:82226048-82226070 CTATGACCACATTAAGAGACAGG - Intergenic
1088672138 11:112152543-112152565 ACATGGCCACACCAAGTGCAAGG - Intronic
1091849083 12:3680637-3680659 CCATGACAACACTCTGAGCTAGG + Intronic
1093198654 12:16160403-16160425 CCATATCCATACTAAGAACATGG + Intergenic
1093651249 12:21648171-21648193 CCATAAAAACAGTAAGAGCAAGG - Intronic
1094763418 12:33561717-33561739 CCATGCCCACACAAAAGGCATGG + Intergenic
1096570052 12:52517507-52517529 CCATGACGACACTAAGAATGGGG - Intronic
1096675753 12:53224904-53224926 CCATGGACACACTGAGATCAAGG - Intronic
1101193912 12:102363131-102363153 CCATGACCACACTAGGTTCAGGG - Intergenic
1102658038 12:114500202-114500224 CCTTGACCACTCTAAGAGGAAGG + Intergenic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1108862936 13:54884549-54884571 CCTTGACCTCACAAAGAGCTGGG + Intergenic
1111905957 13:94256456-94256478 CCAGGAACAGACCAAGAGCAAGG + Intronic
1115190785 14:30745173-30745195 CCTTGAGAACACTCAGAGCAGGG + Intergenic
1115297699 14:31848244-31848266 CCATGACTACATTAAAAGGAGGG - Intronic
1116503010 14:45643657-45643679 TCATGAGCACTTTAAGAGCAGGG - Intergenic
1117767449 14:59097647-59097669 CTATGAGCAAACTAAGAGCTGGG + Intergenic
1120746293 14:88155022-88155044 CAACGACCACACTAAGAGTAGGG + Intergenic
1121778452 14:96606426-96606448 CCATGCATACAGTAAGAGCATGG - Intergenic
1122202753 14:100132511-100132533 CCATGACCACACGGAGGGCCTGG + Intronic
1127485547 15:59414547-59414569 CCAACACCACACCAAGAGAAGGG - Intronic
1127784823 15:62346500-62346522 ACCTGACCCCACTAAGTGCAAGG + Intergenic
1132291238 15:100705251-100705273 CCATCATCACGCTAAGGGCAAGG + Intergenic
1132726718 16:1342095-1342117 CCATGACCAAGCTGAGGGCACGG - Intronic
1135936881 16:26788088-26788110 ACATGACCACACCAACCGCAAGG - Intergenic
1136596131 16:31251301-31251323 CCAAGGTCACACAAAGAGCATGG - Intergenic
1140145448 16:72302594-72302616 CTATGGTCACACAAAGAGCATGG + Intergenic
1141289956 16:82708684-82708706 CCATGACCACTCTAAAAAGAGGG + Intronic
1142172012 16:88627853-88627875 CCATGGCCACACCAACAGCCAGG - Intronic
1142780422 17:2177159-2177181 CCATGGCCCCTCTGAGAGCAGGG - Intronic
1143779486 17:9221851-9221873 CCACGACCACCATGAGAGCAAGG - Intronic
1143889409 17:10091095-10091117 ACATGGCCACAATAAAAGCAGGG - Intronic
1145853036 17:28121988-28122010 CAACTACCACACTAAGAGCTGGG + Intronic
1148700492 17:49583863-49583885 CCCTGTCCACACCAGGAGCAAGG - Intergenic
1151393687 17:73804841-73804863 CACTGAACACACTTAGAGCATGG - Intergenic
1156140962 18:34111034-34111056 CCAAGAACACACAAAGAGAAGGG + Intronic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1157742155 18:50103070-50103092 CCATGAGCACAGTCAGAACAAGG - Intronic
1159554724 18:69933189-69933211 CCATGACCCTACCAACAGCACGG - Intronic
1161298330 19:3530996-3531018 CCAGGACCACACTAAGGCCGGGG - Intronic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1163748046 19:19059621-19059643 CCATGGGCAGACTGAGAGCAAGG - Intronic
1167683725 19:50942367-50942389 ACATGAACACAATGAGAGCAGGG - Intergenic
1167720280 19:51174967-51174989 CCATGACCTCAATAATATCATGG + Intergenic
925427624 2:3763402-3763424 CCATGACCATTCTAGGAGCCTGG - Intronic
925588594 2:5487671-5487693 CCACCACCACTCTAAGACCATGG - Intergenic
926307299 2:11647546-11647568 TCATGACCACAAGAACAGCATGG - Intergenic
926691625 2:15738650-15738672 CCATGACCACAGTCAGAAAACGG + Intronic
931488235 2:62715545-62715567 ACATGGCCACACCAAGTGCAAGG - Intronic
931722412 2:65076960-65076982 CCATGACCACCCTTAGTGCAAGG - Intronic
932439015 2:71720063-71720085 CCAGGACCACCCTAAGACCTGGG + Intergenic
932514144 2:72327370-72327392 TGATAACCACACTAAGACCATGG - Intronic
934993752 2:98938825-98938847 CCCTTCCCACACTAAGAGGAAGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
937871992 2:126792588-126792610 CCATGCTCACACCTAGAGCAAGG - Intergenic
938523021 2:132092152-132092174 CCATGGCCTCACAAAGAGCTAGG - Intergenic
941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG + Intergenic
943009764 2:182433064-182433086 CCATGACCACAGTAGGAGGCTGG - Intronic
943372469 2:187032044-187032066 CCTTGACCACACAAAGTGCTGGG - Intergenic
946228804 2:218279186-218279208 CCATGGTCACCCTGAGAGCAGGG + Intronic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
1169801167 20:9514210-9514232 CCATGAGCTCATTGAGAGCAGGG + Intergenic
1170491937 20:16886241-16886263 CCAAGATCACACTAGAAGCAGGG - Intergenic
1172855455 20:37998651-37998673 CCCTGACAACACTATGAGAAAGG + Intronic
1181578984 22:23816534-23816556 CCATGACCACCCCCAGGGCATGG + Intronic
1184247199 22:43241707-43241729 GCCTGGCCACAGTAAGAGCAGGG - Intronic
959406274 3:105965539-105965561 CCATGCTCACATTAGGAGCATGG - Intergenic
959579184 3:107966921-107966943 TCAGGGCCACAGTAAGAGCAGGG - Intergenic
959617331 3:108362969-108362991 CCTTGACTAAACTCAGAGCAAGG - Intronic
960048571 3:113220014-113220036 CCCTCACCCCACCAAGAGCATGG - Intronic
960308735 3:116094425-116094447 CCATTACCAAACTAAGATTAGGG - Intronic
961682578 3:128608769-128608791 CCATGACCACCCCCCGAGCATGG + Intergenic
962739528 3:138352902-138352924 CCATGACGACACTGAGGGCTGGG - Intronic
963141353 3:141948580-141948602 CCATAACCACACTGAGAGAGGGG - Intergenic
964573078 3:158132234-158132256 CCTTGGCCTCACTAAGTGCAGGG + Intronic
968763934 4:2458494-2458516 CCAAGACCACACTGGGAGGAAGG + Intronic
969108122 4:4823266-4823288 CCATGATCACAAGAACAGCAAGG - Intergenic
969967016 4:11007396-11007418 CCATGACCTTAGTAAGAGGACGG - Intergenic
970455339 4:16217984-16218006 CATTGTCCACACTAAGTGCAAGG + Intronic
975138229 4:70894999-70895021 CAGTCACCACACTAAGAGTAAGG - Intergenic
978835279 4:113142011-113142033 GTTTGACCACACTTAGAGCAGGG - Intronic
982472182 4:155805891-155805913 CCTTGCACACACTAAGATCATGG + Intronic
986970573 5:13331754-13331776 CGATGGCCACACAAAGTGCAAGG - Intergenic
988450767 5:31340794-31340816 CCATGTCCAGCCTTAGAGCAGGG + Intergenic
988471765 5:31546360-31546382 GAAAGACCACACTAAGAGGAAGG - Intronic
989121333 5:38007556-38007578 TCACGACCACAAGAAGAGCATGG + Intergenic
992916485 5:81458855-81458877 AAATGACCACTCTAAGAACAAGG - Intronic
1000961039 5:167601609-167601631 CTATGAACACACTAAAATCAAGG - Intronic
1002399229 5:178981982-178982004 CCAGGACAACAGTATGAGCAGGG + Intronic
1002780745 6:363872-363894 CAACAACCACACTAAGAACAAGG - Intergenic
1003597542 6:7487721-7487743 CCAGGACAACACCAACAGCAGGG + Intergenic
1006193120 6:32221476-32221498 CCATGACATCGCTCAGAGCAGGG - Intronic
1011598506 6:89038744-89038766 CCATGACAACACTCATAGGAAGG - Intergenic
1013384461 6:109611326-109611348 CCATGGGCACAGTAAGATCATGG - Intronic
1023470701 7:40515118-40515140 CCATGACCACAATCAAAACACGG + Intronic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1037852589 8:22344615-22344637 CCTTGACCTCACAAAGAGCTGGG - Intronic
1039391596 8:37185338-37185360 CCCTGACCTTACCAAGAGCAGGG - Intergenic
1042501438 8:69513751-69513773 CCCTGGCCACACCAAGGGCATGG - Intronic
1042919027 8:73903469-73903491 CCATGAAAATACTAAGAACAGGG - Intergenic
1043206452 8:77449747-77449769 CCATGGCCACCCAAAGAGCTGGG - Intergenic
1055421285 9:76145672-76145694 CTGTGACCACACTGAGACCATGG + Intronic
1055526300 9:77137269-77137291 CCATGACCTCACAAAGTGCTGGG + Intergenic
1056708714 9:88972781-88972803 CCAGGACCACACTAGGAACTAGG + Intergenic
1188820162 X:34765380-34765402 ACATAACCACACTGAGAGGATGG - Intergenic
1191226857 X:58053273-58053295 CCAGTACCACACTAAGCACAGGG - Intergenic
1196144364 X:112300773-112300795 CCATAAACACAGTAGGAGCAGGG - Intergenic
1197714656 X:129697742-129697764 CCATGACACCCCTATGAGCAAGG - Intergenic
1197878036 X:131132464-131132486 CCTTGACCTCCCAAAGAGCAGGG + Intergenic
1199514861 X:148664630-148664652 CTGTGAGCTCACTAAGAGCAAGG + Intronic
1201785126 Y:17767891-17767913 CCATGGCCACCCAAAGTGCAGGG + Intergenic
1201816427 Y:18138096-18138118 CCATGGCCACCCAAAGTGCAGGG - Intergenic