ID: 1107350744

View in Genome Browser
Species Human (GRCh38)
Location 13:39512179-39512201
Sequence ACAGGAAATCAGTGTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107350744 Original CRISPR ACAGGAAATCAGTGTTAAGC AGG (reversed) Intronic
902869512 1:19305637-19305659 TCAGGAAATAAGTTTTAACCAGG + Intronic
904434023 1:30482701-30482723 CCAGGTACTCAGTGTGAAGCAGG - Intergenic
905094060 1:35453989-35454011 TGAGGAAGTCAGTTTTAAGCAGG + Intronic
908379171 1:63578533-63578555 GCAGGAGAACAGTGTTAACCCGG - Intronic
909493713 1:76254266-76254288 GAAGGAAACGAGTGTTAAGCTGG + Intronic
910063247 1:83119201-83119223 CCAGGAAAGCAGTCTTTAGCTGG + Intergenic
910204147 1:84730940-84730962 ACAGCAAGGCAGTGTTAAGAGGG - Intergenic
914939461 1:152009858-152009880 ACAGGGAATCAGAGGTTAGCAGG - Intergenic
915102907 1:153513547-153513569 ACTGGAAATCACTGTTAGGATGG + Intergenic
917686233 1:177418847-177418869 ACAAGAAATGAGTCTTAAACAGG - Intergenic
919496351 1:198274413-198274435 GCAGGAAACCTGTGTTATGCAGG - Intronic
919799105 1:201341603-201341625 ACAGGCACTCAGTGATCAGCAGG - Intergenic
919908535 1:202095310-202095332 ACTGCAAATCTGTGTGAAGCTGG + Intergenic
923579353 1:235192997-235193019 ACAGGAGAACAGTGTGAACCCGG + Intronic
923637809 1:235718556-235718578 TCAAGAAATCAGATTTAAGCTGG - Intronic
923740210 1:236647814-236647836 ACAGCAAATCAGCCTTAAGTAGG - Intergenic
1063208658 10:3858351-3858373 ACAGCAAATGAGAGTTGAGCAGG - Intergenic
1063916956 10:10893022-10893044 ACAAGAAACCAGTGTTAAGAAGG - Intergenic
1064179516 10:13102094-13102116 ACAGGACATCATATTTAAGCTGG + Intronic
1066241957 10:33546295-33546317 ACAGGATCTCAGTGTGAAGCTGG + Intergenic
1069956111 10:72052976-72052998 ACAGGTGATCAGGGCTAAGCTGG + Intergenic
1071209442 10:83321094-83321116 ACAGTAAAACAGCGTTAAGAGGG + Intergenic
1073605396 10:104890310-104890332 ACAGAAAATCAGTGTGCTGCAGG - Intronic
1074402536 10:113153739-113153761 ACAGGGATTCAGAGTTAAGTCGG + Intronic
1074789396 10:116871205-116871227 ACAGGAAATCTGTGCCAACCTGG + Exonic
1079742119 11:24075798-24075820 ACAGAAATTCAGTGTTAAAAAGG - Intergenic
1080032883 11:27680492-27680514 ATAGGAAATCAGTTCTAGGCAGG - Intronic
1081743601 11:45457806-45457828 ACAGGCCATGAGTGTGAAGCAGG - Intergenic
1082758085 11:57097744-57097766 GCTGGAAATCAGGCTTAAGCAGG + Intergenic
1083569152 11:63747346-63747368 ACAGGAATTCACTCTTAAGTAGG + Intronic
1084342632 11:68516846-68516868 ACAGGAAATAAGTGTCAATAAGG - Intronic
1084886748 11:72215189-72215211 ACAGGAAATAAGTGTTGATGAGG + Intergenic
1085238291 11:75031938-75031960 ACAGCAAGTCAGTGTTCATCAGG + Intergenic
1085977358 11:81674929-81674951 ACAAGAGATCAGTGTTAAGAGGG + Intergenic
1090864660 11:130688770-130688792 ATAGGAAGTCAGTGTCAATCTGG + Intronic
1093944885 12:25096945-25096967 ACAGGAAATCATTAAGAAGCTGG + Exonic
1094395815 12:30004283-30004305 AGATGAAATCAGAGTTCAGCTGG + Intergenic
1097333077 12:58353408-58353430 AAAGGGAATCAGTTTTAAGAGGG - Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1097848757 12:64390990-64391012 ACAGGAAACCAGATTGAAGCTGG - Exonic
1098231552 12:68376325-68376347 ACAGGAGGCCACTGTTAAGCTGG - Intergenic
1099167683 12:79326625-79326647 ACTTGAAATCAGTGATTAGCAGG - Intronic
1099227237 12:79983840-79983862 AGAGGTAAGCAGTGTCAAGCAGG - Intergenic
1107350744 13:39512179-39512201 ACAGGAAATCAGTGTTAAGCAGG - Intronic
1108189279 13:47920642-47920664 ACAGAAAAGCAGTGCTAAGAGGG + Intergenic
1109071635 13:57776503-57776525 ACAGAAAAGCAGTGCTAAGCAGG - Intergenic
1110143123 13:72155588-72155610 ATAGGAAATGGGTCTTAAGCTGG - Intergenic
1111817750 13:93175215-93175237 ACAGAAAAGCAATGTTAAGAGGG + Intergenic
1114814803 14:25944480-25944502 ATAGGAAATCAATGGTAGGCAGG - Intergenic
1114831670 14:26150368-26150390 AAAGGAAATGATTGCTAAGCTGG - Intergenic
1115096546 14:29644209-29644231 ACAGGATTTCAGTTTTAAGATGG + Intronic
1116428954 14:44823452-44823474 GCAGTAAAGCAGTGTTAAGAGGG + Intergenic
1117078356 14:52126596-52126618 ACAGGAATTTAGTGTCAAGTGGG - Intergenic
1118069932 14:62235312-62235334 ACAGGAAAACATTGTCAATCCGG - Intergenic
1118106997 14:62670933-62670955 ACAGGTAATCAGTGACAAGTCGG + Intergenic
1118185766 14:63536875-63536897 ACAGGGAGTCAGTGTTTAACAGG + Intronic
1118332022 14:64822582-64822604 GCAGGAAATCGGGGTTAACCAGG + Intronic
1119798564 14:77422180-77422202 ATAGGAAATGTGTGTGAAGCAGG - Intronic
1120655490 14:87184723-87184745 ATAAGAAATCAGTGTTAATAAGG - Intergenic
1122380731 14:101305071-101305093 AAAGGAAAGCAGTGTTGAGGAGG - Intergenic
1124206451 15:27724871-27724893 TCAGGAACTCAGTGTTATCCAGG + Intergenic
1126057702 15:44747134-44747156 ACAGGCAAGCAGGCTTAAGCTGG + Intronic
1127028008 15:54829450-54829472 ACAGAGAATCAGTGTTAAAAGGG - Intergenic
1130174972 15:81559123-81559145 ACAGGAAAGCAGTGGGCAGCAGG + Intergenic
1130406276 15:83604918-83604940 ACAGGGAATCTGTGGTCAGCAGG + Intronic
1131397177 15:92095855-92095877 ACAGGAAACCAGTTTTACTCTGG + Intronic
1131674593 15:94659344-94659366 AAAGGAAATCAATGCTCAGCAGG - Intergenic
1132146093 15:99430893-99430915 CCGGGAACGCAGTGTTAAGCAGG + Intergenic
1132256836 15:100383563-100383585 AAAGGAATTCAGTGATAAGCAGG - Intergenic
1132904854 16:2277393-2277415 AAAGGAATTCAGTGTAAAACAGG - Intronic
1133887406 16:9843539-9843561 AAAGGAAAGCATTGATAAGCAGG - Intronic
1134761959 16:16722485-16722507 ACAGAAAATCGGTGTTAAAGCGG - Intergenic
1134984099 16:18636685-18636707 ACAGAAAATCGGTGTTAAAGCGG + Intergenic
1135181069 16:20275093-20275115 GCATGAAATGAGTGCTAAGCTGG - Intergenic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1138909315 16:61377276-61377298 AGAAGAAATCAGTGTGAAACAGG + Intergenic
1139162834 16:64532604-64532626 AAAGGAAATGAGTTTTAAGATGG + Intergenic
1140047508 16:71451911-71451933 ACAGCAAATGAGTCTTAAACAGG + Intronic
1141798866 16:86293799-86293821 ATAGGAAATCAGTGTTAAAAAGG + Intergenic
1150530256 17:65973693-65973715 ACAGGAAATCAGTGGTTGCCTGG + Intronic
1158729743 18:60010225-60010247 ACAGGAAATCAGTTTGCTGCAGG - Intergenic
1162763176 19:12900696-12900718 ACAAGACATCTGTGTTAAGTGGG + Intronic
1162969465 19:14171437-14171459 CCAGGAAAGCACTGTTTAGCGGG - Intronic
1163983630 19:20924569-20924591 ACTGTAAATCAGAGTTAATCTGG - Intronic
1165989891 19:39804508-39804530 AAAGGAAATGAATGTTGAGCAGG + Intergenic
928612560 2:33004894-33004916 CCAGGAAATCATTGGAAAGCTGG + Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929179622 2:39022512-39022534 AAAGAAAATCAGTTTGAAGCAGG + Intronic
931692484 2:64847074-64847096 AAAATAAATCAGTGTTAAGGAGG - Intergenic
932206941 2:69891774-69891796 ACAGGAAAATAGTGTGAACCTGG - Intergenic
934706221 2:96483408-96483430 ACAGGAAAACAGAATTAATCAGG + Intergenic
935522287 2:104122166-104122188 ACAGGGAAGCAGTGATGAGCTGG + Intergenic
935870417 2:107442141-107442163 ACTGGAAATCAGACTGAAGCTGG - Intergenic
937411246 2:121678100-121678122 ACTGGAAATCAGGGTTAGGCTGG - Intergenic
937627507 2:124059907-124059929 AAAGGAAAGCAATGTTATGCTGG + Intronic
937641802 2:124220941-124220963 TCAGGATATCAGTGTCAACCCGG + Intronic
938245334 2:129772326-129772348 ACATGAAATCAGTCTTAATTGGG - Intergenic
938719840 2:134056874-134056896 ACAGGAAATCAAATTTAAGGGGG - Intergenic
938981222 2:136529031-136529053 ACATGAAACCAGTGTGAAGAAGG - Intergenic
941104593 2:161338829-161338851 ACAGCAAATCAGTGGTAGTCTGG - Intronic
941522589 2:166565569-166565591 ACTGTAAAACAGTCTTAAGCAGG - Intergenic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
948312061 2:236994803-236994825 CCAAGAAATCAGTTTGAAGCAGG - Intergenic
1169525644 20:6422529-6422551 GCAGGGAATCAGTGGTAAGGTGG + Intergenic
1170050814 20:12143425-12143447 AAAGGAATACAGTGGTAAGCTGG - Intergenic
1171360605 20:24584072-24584094 GCAGGGAATCAGGGTGAAGCTGG - Intronic
1171469209 20:25356546-25356568 AAAGGAAATCACTGTCAAACTGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1177826220 21:26086641-26086663 ACAGTAATTCTTTGTTAAGCAGG + Intronic
1178941128 21:36907298-36907320 AAAGGAAAAAAGTGATAAGCTGG + Intronic
1179642008 21:42753958-42753980 ACAGGAGTTCCGTGTTAACCAGG - Intronic
1182870984 22:33647426-33647448 GCAGGAAAGAAGTGTTAAGGTGG - Intronic
950800340 3:15546138-15546160 ACAGCAAAGCAGTGCTAAGAGGG - Intergenic
952663978 3:35881979-35882001 ACAGGAAATCTGGGGCAAGCTGG - Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
954526428 3:51275791-51275813 AAAAGAAATCAGTGGTAAGAGGG + Intronic
960935531 3:122899098-122899120 ACAGACAAGCAGTGTTGAGCTGG - Intergenic
963634191 3:147773604-147773626 ACAGAAAATCTGTGATTAGCTGG - Intergenic
964390979 3:156197940-156197962 ACAGTTAAGCAGTGTTAAGACGG - Intronic
969150180 4:5162710-5162732 ACAGGAAATCACAGTTAATGAGG - Intronic
969580675 4:8062918-8062940 AGAGGAAGTCAGTGTGAAGTGGG - Intronic
975414077 4:74087858-74087880 ACAGGACATCAGGTTTAAGTTGG - Intergenic
977145201 4:93431033-93431055 ACAGGAAATCAGAGATAAAAAGG + Intronic
978483842 4:109227740-109227762 ACAGCAAATCTGTGTTACTCAGG + Intronic
979422253 4:120519500-120519522 ACAGGAAATCAGTTACAAACTGG - Intergenic
982852668 4:160339626-160339648 ACAGTTAAGCAGTGTTAAGAGGG - Intergenic
983086729 4:163454401-163454423 TCAGGAAATGAATGTTAATCAGG + Intergenic
983248383 4:165315801-165315823 ACATGTATTCAATGTTAAGCGGG + Intronic
986226704 5:5822518-5822540 ACAGGAAATTAGTATACAGCTGG + Intergenic
990330602 5:54721754-54721776 ACAGGAATTTAGAGTTAAGAAGG + Intergenic
990783260 5:59391083-59391105 AGAGGAAATCAGAGTTAAGGAGG + Intronic
990799290 5:59582048-59582070 ACAGGAATTCAGAATTAAGCTGG + Intronic
991556598 5:67901900-67901922 AAAGGACATCAGTGTTACTCTGG + Intergenic
992428299 5:76681545-76681567 ACAGAAAATAAGTGTTGAGAAGG + Intronic
993270872 5:85794250-85794272 ACAGCTAAGCAGTGTTAAGAGGG + Intergenic
993489930 5:88534720-88534742 AAAAAAAATCAGTGTTATGCTGG + Intergenic
993596791 5:89866351-89866373 ACAGGAATTCACAGTTAATCAGG - Intergenic
999391958 5:151199673-151199695 CCAGGAACTCAGTGGTATGCTGG - Intronic
1000294156 5:159898251-159898273 ACAGGGAACCAGTGATATGCAGG - Intergenic
1000470654 5:161636875-161636897 ACAGGAAGTCAATATAAAGCAGG + Intronic
1002042808 5:176527212-176527234 ACAGGAAATCATTGGTAACATGG + Exonic
1003215030 6:4101394-4101416 GCAGGAAAACAGTGTTGGGCAGG + Intronic
1003813088 6:9806033-9806055 ATCAGAAATCAGTGTTAAGTGGG - Intronic
1003858290 6:10298025-10298047 ACAGGAAATCCTTTTTAAGTTGG + Intergenic
1004398167 6:15264713-15264735 ACTGGAAATCTGTGTTCTGCCGG + Intronic
1010370654 6:75103308-75103330 ACAGAAAACCAGTGTGGAGCTGG + Intronic
1010505825 6:76657974-76657996 ACAAGAGATAAGTGTTAAGGAGG + Intergenic
1011587063 6:88937693-88937715 ACAGCAAAGCAGTGCTAAGAAGG - Intronic
1012163354 6:95916308-95916330 TCAAGAAATCTGTGTTCAGCTGG - Intergenic
1013870421 6:114751945-114751967 ATAGGAAAACAATGTTATGCTGG + Intergenic
1014825106 6:126040993-126041015 TAAGGAAATCAGTGGCAAGCTGG - Intergenic
1016943799 6:149508703-149508725 ACAGGAAATGCGTATTCAGCTGG - Intronic
1017406868 6:154128885-154128907 ACAGGAAATTAATGTTAAATTGG + Intronic
1019624787 7:2010619-2010641 GCAGGAAAACAGTGTTGAGTTGG - Intronic
1023558662 7:41449565-41449587 AAAGGAAATGATTGTTAAGGAGG + Intergenic
1023901610 7:44485448-44485470 ACAGGTAAACAGTGTTTAACAGG + Intronic
1026373503 7:69725925-69725947 ACAAGAAATCATTGTGATGCAGG + Intronic
1028484945 7:91347590-91347612 TTAGGAAATCAGGGTTAAGATGG + Intergenic
1029976439 7:104839199-104839221 ACAGGATAGCAGTGTTAAATTGG + Intronic
1030156665 7:106462152-106462174 AAAGGACATCAGTCTTAAGGTGG + Intergenic
1030199208 7:106885219-106885241 GCAGGAAATGAGTCTTAAGAAGG + Intronic
1031368042 7:120927355-120927377 GCAGGAAATGAGGGTTAAGTGGG - Intergenic
1032359769 7:131244538-131244560 CCAGGAAACCAGTTATAAGCAGG - Intronic
1033086647 7:138348519-138348541 ACACTAAATCAGAGTTAAGCAGG + Intergenic
1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG + Intergenic
1035877290 8:3204998-3205020 ACAGGAAGTCAGGGTTCAGCAGG + Intronic
1036027721 8:4928642-4928664 ACAGGAATTCATTGTTACTCAGG + Intronic
1036742941 8:11381712-11381734 CCAAGAAATCATTGATAAGCTGG - Intergenic
1041825022 8:62085410-62085432 TCATGAAATCAGTTTTAAGCTGG + Intergenic
1042589230 8:70380083-70380105 ACAGGAAACAAGTGTCAAGCAGG + Intronic
1043229637 8:77785604-77785626 ACAGCTAAGCAGTGTTAAGATGG - Intergenic
1048642961 8:136384969-136384991 ACAGGAAATTAGGCTTCAGCTGG + Intergenic
1049713145 8:144076256-144076278 ACAGGAAATCAGGCGTGAGCTGG - Intergenic
1055147335 9:72952198-72952220 ACAGGAAAGCAGTGTGAAACAGG + Intronic
1056542989 9:87590318-87590340 TCAGGAAAACACTGTTAAGGTGG - Intronic
1057348350 9:94272861-94272883 ACAGAAAATAAGTGTTAACAAGG - Intronic
1058109937 9:101021303-101021325 ACAGGAAATAAGTGTTGACAAGG - Intergenic
1061635424 9:131905380-131905402 ACAGGAACACAGTGTGAGGCAGG - Intronic
1188855913 X:35195653-35195675 ACAGTAAAACAGTTTTAGGCAGG + Intergenic
1191175317 X:57493861-57493883 ACAGCAAAACAGTGCTAAGAAGG + Intergenic
1191695236 X:63983044-63983066 ACTGTAAATCAGTGATAAGAGGG + Intergenic
1192112267 X:68377188-68377210 GCAGGAGAACAGTGTGAAGCCGG - Intronic
1192333566 X:70199589-70199611 ACAGGAAAATAGTCTGAAGCTGG - Intronic
1194787346 X:98103057-98103079 GCAGGAAAGCAGTGCTAAGAGGG - Intergenic
1195144853 X:102003067-102003089 ACAGTTAAGCAGTGTTAAGAGGG + Intergenic
1195613503 X:106894902-106894924 ACAGGCAATGAGTGGGAAGCTGG - Intronic
1196168238 X:112558385-112558407 ACAGTTAAGCAGTGGTAAGCAGG + Intergenic
1199930257 X:152511114-152511136 ACAGGACATCAGACTTAACCAGG + Intergenic
1200269110 X:154664785-154664807 ACAGGAACTCACTGTTGACCTGG + Intergenic
1201598859 Y:15705081-15705103 ACTGGAAATCATGTTTAAGCAGG - Intergenic
1201763793 Y:17562389-17562411 ACAGGAAATCAGCCTTGAACGGG - Intergenic
1201837760 Y:18343601-18343623 ACAGGAAATCAGCCTTGAACGGG + Intergenic