ID: 1107353043

View in Genome Browser
Species Human (GRCh38)
Location 13:39536334-39536356
Sequence CACTCAGATCTCCCTTCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107353041_1107353043 -9 Left 1107353041 13:39536320-39536342 CCACGGAGTTGTACCACTCAGAT 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1107353043 13:39536334-39536356 CACTCAGATCTCCCTTCGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1107353039_1107353043 8 Left 1107353039 13:39536303-39536325 CCACTTGCTTTTGATGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1107353043 13:39536334-39536356 CACTCAGATCTCCCTTCGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107353043 Original CRISPR CACTCAGATCTCCCTTCGAG AGG Intronic
901976252 1:12946598-12946620 CACCCATGTCTCCATTCGAGTGG + Intronic
902008920 1:13255172-13255194 CACCCATGTCTCCATTCGAGTGG - Intronic
906920701 1:50061594-50061616 CATTCAGATCTGCCTTTAAGAGG + Intronic
907241399 1:53083280-53083302 CACACAGGGCTCCCCTCGAGAGG - Intronic
907475723 1:54704031-54704053 CACTCAGATGTCCCTTCACACGG - Intronic
911575740 1:99575512-99575534 CACTCAGATCTTCCTCTGAAGGG - Intergenic
918523380 1:185439301-185439323 CACTCACATCTCCCTCCTTGTGG - Intergenic
919936606 1:202255086-202255108 CACACAGGTCTTCCTTCAAGTGG - Intronic
920848488 1:209612666-209612688 CACTCAGCTCTCCCCTCATGAGG - Intronic
923888309 1:238182034-238182056 CACTCAGTTCTCCCTTGCTGAGG + Intergenic
1071220688 10:83461695-83461717 CCCTCAGATCTCCCCTAGAGAGG + Intergenic
1075246149 10:120823741-120823763 CACTCCCATCTCCCATCTAGAGG - Intergenic
1077606794 11:3617672-3617694 CACTCAGGGCTCCCCTGGAGTGG - Intergenic
1078027292 11:7709131-7709153 CCCTCACATCTCCCTCCCAGGGG + Intergenic
1081229056 11:40562670-40562692 CACTTAGATTTCTCTTCAAGAGG + Intronic
1084757101 11:71246542-71246564 AACTAAGATCTCCCTTGCAGGGG + Intronic
1089114248 11:116081332-116081354 AACTCAGATTTTCCTTTGAGGGG - Intergenic
1091698358 12:2643115-2643137 CCTTCAGAACTCCCCTCGAGGGG - Intronic
1091752797 12:3033130-3033152 CAATCAGAACCCCCTTGGAGTGG + Intronic
1093678858 12:21976743-21976765 TGCTCAGATCTTCCTTCAAGAGG - Intergenic
1093678921 12:21977565-21977587 TGCTCAGATCTTCCTTCAAGAGG - Intergenic
1096374267 12:51095164-51095186 CATTCATATCCCCCTTCAAGAGG + Exonic
1096972676 12:55680624-55680646 CACTCAGATCTCCTCTCTGGAGG - Intergenic
1099183961 12:79497896-79497918 CACTCAGATCTGACTTACAGTGG - Intergenic
1102629752 12:114267432-114267454 CAATTAGATCTCCCTAAGAGGGG + Intergenic
1103864688 12:124042555-124042577 CACACAGATCTCTCTTCTATGGG + Intronic
1104077134 12:125399974-125399996 CACTCAGAGCTGCCTTGGATGGG + Intronic
1106952877 13:34904639-34904661 CACTCAGTCCTGCCTTCCAGTGG + Intergenic
1107353043 13:39536334-39536356 CACTCAGATCTCCCTTCGAGAGG + Intronic
1107772588 13:43805209-43805231 CACTGAGTTCTCCTTTGGAGAGG - Intergenic
1110762058 13:79241618-79241640 AAATCACATCTCCCTACGAGTGG - Intergenic
1114393780 14:22338273-22338295 CACCCAGGTCTCCCTGGGAGAGG + Intergenic
1129231929 15:74201782-74201804 CAAGCAGACCTCCCTTCAAGGGG - Intronic
1138202914 16:55103319-55103341 AACTCAGAGCTTCCTTCAAGAGG - Intergenic
1142980376 17:3668056-3668078 CCCCCAGATCTCCCTCCGGGCGG + Intronic
1147776258 17:42903805-42903827 CACCCAGTTCTCCCTTCTAGAGG + Intronic
1163176383 19:15566640-15566662 AACTCAGAGCTCACTTCTAGAGG - Intergenic
1163518837 19:17780105-17780127 CACTCAGCTCTCCCTTGAACGGG - Intronic
1165124203 19:33582404-33582426 CACCCAGATCTCCTCTCCAGGGG + Intergenic
1166670349 19:44706112-44706134 CACTCAGATATCACTTCAGGTGG + Intronic
1168439822 19:56354600-56354622 AACTAGGATCTCCCTTGGAGTGG - Intronic
926542126 2:14193908-14193930 CCCTCAGATCTCCCTCCGACAGG - Intergenic
926969370 2:18451690-18451712 CACTCAGATCTTCCTTAAGGAGG + Intergenic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
930284900 2:49415357-49415379 GACTGAGATCTCCCCTGGAGAGG - Intergenic
940149458 2:150583559-150583581 CACTCAGATCTACTTGAGAGGGG + Intergenic
945956421 2:216090383-216090405 CACTCAGATGGCCCATGGAGAGG + Intronic
1169476901 20:5939895-5939917 CCCTCAGATCTCCCTTCATGAGG + Intronic
1176132012 20:63500180-63500202 CACTCGGATCTTCCTGCCAGCGG + Intergenic
1178978825 21:37244025-37244047 CACTCAGAGCCTGCTTCGAGGGG + Intronic
1183176943 22:36231274-36231296 CACTCAGATCTCCCCTGGGCTGG - Intronic
1183508324 22:38221316-38221338 CACTCACATGTCACTTCCAGAGG - Exonic
1185170840 22:49293047-49293069 CATTCAGATATGCCTTCGAATGG - Intergenic
952225240 3:31368715-31368737 CACTCAGTTCCCCTTTCTAGGGG - Intergenic
959337750 3:105087517-105087539 CTGTCAGATCTCCCTTCAGGAGG + Intergenic
960640966 3:119822606-119822628 GACTGAGATCTACCTTTGAGAGG - Intronic
960901352 3:122557452-122557474 TACTCAGATCTCCCTGCGATTGG + Intronic
960953702 3:123016210-123016232 CACCCAGACCTCTCTTTGAGGGG + Intronic
962353852 3:134677311-134677333 CACTCAAATCTCCCAAAGAGTGG + Intronic
966824016 3:183948633-183948655 TACCCAGTTCTCCCTTCCAGTGG + Intronic
968348130 3:198028769-198028791 CACTCACTTCTCCCTTCGGAGGG + Intronic
969324588 4:6433995-6434017 CACTCAGCTCTCCTGTCTAGTGG + Intronic
969724131 4:8909171-8909193 CACTCAGATGGCACTTGGAGCGG + Intergenic
970289474 4:14555433-14555455 CACTCAGAGCTCCCCGCAAGAGG - Intergenic
971506332 4:27370068-27370090 CCCTCAGAGCTCCCTTCAGGGGG - Intergenic
972613006 4:40672482-40672504 CACTCAGATCTCTGCTCAAGTGG - Intergenic
974499423 4:62680421-62680443 AACTCATATCTTTCTTCGAGAGG - Intergenic
981049145 4:140293760-140293782 CACTCAGATCTCCTTTTAAGGGG - Intronic
985678730 5:1245243-1245265 CACTCTGATCTCTCCTCGGGAGG - Intronic
989758133 5:44981029-44981051 CACTCATGTCTCCTTTTGAGAGG - Intergenic
992947728 5:81825739-81825761 CACTCAGATCTACCTGAGGGTGG + Intergenic
998070917 5:139197601-139197623 CACTCAGAGCCCCATTCCAGGGG + Intronic
1000569566 5:162895441-162895463 AACTCAAATCTCCTTTGGAGTGG - Intergenic
1009822406 6:68820104-68820126 CACTCTGATCTACCTTCTACTGG + Intronic
1013773238 6:113650597-113650619 CATTCAAATCTTCCTTCCAGAGG + Intergenic
1015822242 6:137276693-137276715 AACTCAGATCTCTGTTCGAAGGG - Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1019379734 7:714564-714586 CACTCAGATCCCTGTTCCAGTGG + Intronic
1020154701 7:5713213-5713235 CACTCAGCTCTGCTTTCCAGAGG - Intronic
1022844020 7:34191856-34191878 CACTGTGATCTCCCTCTGAGTGG + Intergenic
1023169794 7:37379374-37379396 CACTAAGATCTTCCTTGAAGGGG + Intronic
1039404427 8:37300476-37300498 CACCCTGATCTCCCTTTCAGTGG + Intergenic
1045465928 8:102469798-102469820 CACTCAGATCTTCCTTCAACCGG + Intergenic
1047560503 8:125982805-125982827 CACTCATATATGCCTTTGAGGGG + Intergenic
1049101260 8:140580542-140580564 CACTCGGAGCTCCCCTCCAGCGG + Intronic
1051934252 9:22425648-22425670 CACTCAGCTCTCCCTTTGAGAGG + Intergenic
1056842428 9:90009354-90009376 GACTCTGCTCTCCCTTCCAGTGG + Intergenic
1190047862 X:47127078-47127100 CACCCAAATCTCACTTCGAATGG - Intergenic
1195171617 X:102274089-102274111 CACCCAGACCTCCCCTCAAGAGG + Intergenic
1195187243 X:102413010-102413032 CACCCAGACCTCCCCTCAAGAGG - Intronic
1195857929 X:109350677-109350699 CTCTAAGTTCTCCCTTCTAGAGG + Intergenic