ID: 1107355146

View in Genome Browser
Species Human (GRCh38)
Location 13:39558411-39558433
Sequence AATGTCCTATTGAACTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107355146_1107355147 -5 Left 1107355146 13:39558411-39558433 CCAGCAAAGTTCAATAGGACATT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1107355147 13:39558429-39558451 ACATTTTGACAACACATAATTGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107355146 Original CRISPR AATGTCCTATTGAACTTTGC TGG (reversed) Intronic
909254815 1:73406863-73406885 AATGTACTAGTTACCTTTGCTGG + Intergenic
909519917 1:76555817-76555839 AATTTCTTATTGAATTTTCCTGG - Intronic
909554338 1:76936585-76936607 CATGTGCTATTGAAATTTGAAGG + Intronic
909708383 1:78614575-78614597 AATATCTTCTTTAACTTTGCAGG + Intergenic
912197678 1:107418582-107418604 CATATCCTATTAAACTTTGGAGG - Intronic
912617604 1:111120770-111120792 AATGTCCTATTGAAATCTCTGGG - Intronic
912651059 1:111440020-111440042 TATGTACTTTTGAGCTTTGCAGG - Exonic
913067773 1:115272371-115272393 AATATCCTACTGATCTTTTCAGG + Intergenic
917922449 1:179762069-179762091 AATGTCCCATTGATTTTGGCAGG + Intronic
921470573 1:215543410-215543432 CCTGTACTCTTGAACTTTGCGGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066479171 10:35778926-35778948 AATGTCATTCTCAACTTTGCTGG + Intergenic
1066674953 10:37878038-37878060 AATGTCCTCTGTAGCTTTGCTGG + Intergenic
1068360082 10:55966514-55966536 AATGTCCCACTGAGCCTTGCAGG + Intergenic
1070264776 10:74891951-74891973 AATGCCCATTTGAACTCTGCTGG - Intronic
1071594070 10:86905532-86905554 ACTTTCCTATTGAATTTTGAAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080593897 11:33750795-33750817 ATAGTCCTATTAAACTTTGAAGG + Intronic
1080963808 11:37190871-37190893 AAAGTCTTATTGACCTTAGCAGG + Intergenic
1081948049 11:47016491-47016513 AATTTCCAATTGTTCTTTGCTGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1088232314 11:107685704-107685726 AATGTATTATTGAATTTTGCAGG - Intergenic
1088972159 11:114783082-114783104 ATTGTCGTTTTGGACTTTGCAGG - Intergenic
1089266756 11:117269297-117269319 AAGGTTCTTTTGAACTTTGGGGG + Intronic
1092240380 12:6832458-6832480 AATGTGCTATTGATCTCTACTGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1094158231 12:27360340-27360362 ATTGTCCTAATGTCCTTTGCTGG - Intronic
1094530576 12:31270777-31270799 AATGGCCTATGGACCTTTCCTGG - Intergenic
1096954572 12:55512752-55512774 AATGTCCTTTTGGAATTTGGAGG - Intergenic
1097781104 12:63705979-63706001 AATGTCCTATTGGAATTTAAAGG + Intergenic
1106014411 13:25854677-25854699 AAAGTGCTATTGAACAATGCAGG - Intronic
1107355146 13:39558411-39558433 AATGTCCTATTGAACTTTGCTGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108051463 13:46445032-46445054 AGTTTACTATTGAACTTTGAAGG - Intergenic
1108066303 13:46581145-46581167 CATGTCATTTGGAACTTTGCAGG + Intronic
1108688409 13:52840781-52840803 AATTCCATATTGAACTATGCAGG + Intergenic
1109056663 13:57558648-57558670 AAAGTTCTATTGCACTGTGCTGG + Intergenic
1109544017 13:63818657-63818679 AGTTTACTATTGAACTTTGAAGG - Intergenic
1110681989 13:78324850-78324872 AATGTGCTATGGAAATTTCCTGG - Intergenic
1115452296 14:33561747-33561769 ACTGGCTTATTAAACTTTGCTGG - Intronic
1116173959 14:41441567-41441589 AATGTCCTGTGGAACTCTGCAGG + Intergenic
1116266941 14:42704280-42704302 AAAGTCTTATTGAAATTTGTTGG + Intergenic
1119446382 14:74667519-74667541 AATCTTCTATTTAAATTTGCTGG - Exonic
1119889066 14:78169103-78169125 CATGTGCTATTAAAGTTTGCTGG + Intergenic
1120509115 14:85391822-85391844 AAAGTTCTATTGGACTGTGCTGG - Intergenic
1122184546 14:99980831-99980853 AATGTTATTTTGAATTTTGCTGG + Intronic
1125213763 15:37245520-37245542 AATGTCATTATGAAGTTTGCAGG + Intergenic
1128787885 15:70411675-70411697 AAAGTCCTATTCAAATATGCGGG + Intergenic
1130431206 15:83848972-83848994 ACTGTCTTATTGAAATTTGGTGG - Intronic
1135129501 16:19840858-19840880 GAAGTCCTAATGGACTTTGCAGG - Intronic
1135829555 16:25761263-25761285 AATGTCCTATTGAGCAGGGCAGG - Intronic
1140655265 16:77133302-77133324 AATGTGGGTTTGAACTTTGCCGG - Intergenic
1141009461 16:80383893-80383915 AAAGTTCTATTGGACTGTGCTGG - Intergenic
1141806221 16:86343378-86343400 AATGTCAAAATGAACTTGGCCGG - Intergenic
1142752484 17:1997378-1997400 AATGTGATATTGTACTTGGCCGG - Intronic
1143048408 17:4101514-4101536 GATGTGCTTTTCAACTTTGCTGG - Intronic
1148095628 17:45051184-45051206 ACTGCCCTTTAGAACTTTGCGGG - Intronic
1148288463 17:46418330-46418352 AAAATCCTCTTGAACTTTTCTGG + Intergenic
1148310631 17:46635908-46635930 AAAATCCTCTTGAACTTTTCTGG + Intronic
1148532683 17:48409867-48409889 AATGACTTCTTGAAATTTGCAGG - Intronic
1149479720 17:56993333-56993355 AAAGTTCTATTGAACAATGCAGG + Intronic
1149921410 17:60663325-60663347 AATGTCCTTTTAAAGTTTGTTGG - Exonic
1152167543 17:78720192-78720214 AATGTACTACTGAACTTAACAGG + Intronic
1154929537 18:20978399-20978421 AATGTCCAATAAAACTTTCCAGG + Intronic
1156390556 18:36646813-36646835 AATGTCCTGTTTACCTTTGATGG - Intronic
1158354133 18:56597480-56597502 AATGTGATATTGAAATTAGCTGG - Exonic
1161455490 19:4367770-4367792 AATGTCCCATGGAACATGGCGGG + Intronic
1163938163 19:20469622-20469644 AGCTTGCTATTGAACTTTGCTGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1166533281 19:43555081-43555103 CATGTCCTAAGGAACTTTCCCGG + Intronic
929301177 2:40305133-40305155 CTTGTCCTATTCATCTTTGCTGG + Intronic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933595348 2:84277831-84277853 AATTTCCTATTGTCCTTTCCTGG - Intergenic
940714733 2:157207923-157207945 AATGCCCAATTGAAGTTTGATGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942865898 2:180674541-180674563 TATCTCCTATAGAACTTTACTGG - Intergenic
943060803 2:183039393-183039415 AATGTCTTATTGAATGTGGCGGG - Intergenic
947069875 2:226276817-226276839 AGTGTCCTTTTGAAATCTGCAGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947960727 2:234234829-234234851 AATGTCCTATTCATCTTTGATGG - Intergenic
948104057 2:235398753-235398775 CATGTCCTCTTGAACTGAGCAGG - Intergenic
1170326411 20:15159024-15159046 AATTTCCTCTTTAACTTTGTGGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1174567623 20:51478011-51478033 AAAGTCCTATTGAACAATGCTGG + Intronic
1177499749 21:21938172-21938194 AATGTCCAAATGAACTTTTCAGG + Intergenic
1180020449 21:45121763-45121785 AATGACCAATTGGACTTGGCAGG - Intronic
1184663920 22:45977660-45977682 AATCTCCCATTGAGGTTTGCTGG - Intergenic
951110569 3:18798681-18798703 TATGGCCTATTGATATTTGCTGG - Intergenic
952043786 3:29292797-29292819 AATGTACTTTTGAACATTTCTGG + Intronic
955588030 3:60502524-60502546 TCTGTCCTCTAGAACTTTGCAGG - Intronic
955785920 3:62538812-62538834 GATGACCTATTTCACTTTGCTGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957404601 3:79761446-79761468 AATGTAATATTGAAGTTTTCTGG - Intronic
957979582 3:87491357-87491379 AATATCCTATTTAGTTTTGCAGG + Intergenic
958048446 3:88315796-88315818 AATGTCATATTGATCTTTGCAGG - Intergenic
958592543 3:96175903-96175925 AATGTACTATTTAACTTTACAGG + Intergenic
958988067 3:100806347-100806369 AATGACTTTTTGAAATTTGCAGG + Intronic
959475486 3:106806684-106806706 AATGTTTTATTCAACTGTGCTGG + Intergenic
960261285 3:115571461-115571483 AATGGCCTAGTGAACCTTTCAGG - Intergenic
962652148 3:137507296-137507318 AATGTGCTATAGAAGTTTGAAGG - Intergenic
965450734 3:168834529-168834551 AATGTGCTGTTTTACTTTGCAGG + Intergenic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967942015 3:194773406-194773428 AATGTCCTATTGACCTAAGGAGG - Intergenic
969069177 4:4519436-4519458 AAAGTCCTAATGAAATTTTCAGG + Intronic
969231406 4:5834240-5834262 AATGTCCAGTTGAATTTTGAGGG - Intronic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
975948243 4:79735457-79735479 ATTATCCTCTTGCACTTTGCTGG - Intergenic
979222262 4:118241358-118241380 AAAGTTCTATTGAACAGTGCTGG + Intronic
979533582 4:121794944-121794966 TACCTCCTATTGAACTTTGCTGG + Intergenic
981144933 4:141313048-141313070 GATGTCCCATGGAACTTTCCTGG + Intergenic
982283090 4:153706061-153706083 TATTTCCTATTAAACTTTACAGG + Intergenic
984055887 4:174928700-174928722 AAAGTACTAGAGAACTTTGCAGG + Intronic
984894180 4:184521798-184521820 AATGTCCTTTTGAAGATTGAGGG - Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
988692461 5:33586268-33586290 AACCTCCTAATGAACTTTGCTGG - Intronic
989484241 5:41969822-41969844 AATGTAGTATTGAGCTTTGGGGG - Intergenic
993681872 5:90888534-90888556 AATGTGCTTGTGGACTTTGCAGG + Intronic
994671506 5:102766798-102766820 AATGTACTATTAAAATTTGGAGG - Intronic
1000763939 5:165261682-165261704 ACTGTCCTGTTGACCTTTGAGGG + Intergenic
1003014677 6:2458762-2458784 GATGTTCTAATGAACTTTGTTGG + Intergenic
1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG + Intronic
1008766155 6:54917955-54917977 TTTGTCATATTTAACTTTGCAGG - Intronic
1011788879 6:90876559-90876581 CATTTCCTATTGAACTTTTAGGG + Intergenic
1012456560 6:99413146-99413168 CATGTCCTATTTATCTTTCCAGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1024393246 7:48838753-48838775 TTTGTCATATAGAACTTTGCTGG - Intergenic
1028314204 7:89379725-89379747 AAAGTCCTATTGAAGTTTTTTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037600416 8:20389216-20389238 AATGGCCTATTAAAGTTTCCTGG + Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1047729677 8:127716759-127716781 AATGTCCTATTGATTTCTTCAGG + Intergenic
1047904363 8:129457050-129457072 CATGTCCTATTAACCTTTGTTGG + Intergenic
1048008909 8:130441154-130441176 AGGGTCCTATTCATCTTTGCAGG + Intronic
1055254403 9:74350300-74350322 AATCTCCCATTGAACTATCCTGG + Intergenic
1055536161 9:77247595-77247617 AATGACCAATTAAACTCTGCAGG + Intronic
1055861963 9:80762444-80762466 AATGTCCTCTTGATATTTACTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060466708 9:123913139-123913161 AATTTCCTGCTGAACTTTGAAGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186900645 X:14051714-14051736 ACTGTCCAATAGAACTTTCCAGG + Intergenic
1189335072 X:40166207-40166229 ACTGTCTTATTCACCTTTGCAGG - Intronic
1190764915 X:53467974-53467996 AATGTTTTATTGAACGGTGCTGG + Intergenic
1192933091 X:75828824-75828846 AATGTGATTTTTAACTTTGCAGG + Intergenic
1198507863 X:137318999-137319021 ACTCTCCTATTGATATTTGCAGG + Intergenic
1201242754 Y:11974672-11974694 AATTTCATAATGAATTTTGCTGG + Intergenic
1201574037 Y:15443256-15443278 CCTGTCCTATTTAACTTTTCAGG + Intergenic