ID: 1107357339

View in Genome Browser
Species Human (GRCh38)
Location 13:39582130-39582152
Sequence GAGACTGATGTGTCTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107357339_1107357343 4 Left 1107357339 13:39582130-39582152 CCTCCTGTAGACACATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1107357343 13:39582157-39582179 AGCAGCGGCCTCATTCTACGAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1107357339_1107357344 11 Left 1107357339 13:39582130-39582152 CCTCCTGTAGACACATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1107357344 13:39582164-39582186 GCCTCATTCTACGAGGCTCATGG 0: 1
1: 0
2: 0
3: 31
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107357339 Original CRISPR GAGACTGATGTGTCTACAGG AGG (reversed) Intronic
900505259 1:3027201-3027223 GTGACTGCTTTGTCTGCAGGTGG + Intergenic
904494707 1:30880097-30880119 GAGGCTGATGGGTTTCCAGGAGG - Intronic
905945068 1:41894999-41895021 GAGACTGTTGTGTTTTCTGGGGG - Intronic
906872757 1:49502656-49502678 CAGACTGATGTGGATTCAGGTGG + Intronic
912243287 1:107934543-107934565 GACAAAGATGTGTCTCCAGGAGG + Intronic
915897207 1:159821405-159821427 GAGACTGAGGAGGCTACTGGCGG - Intergenic
916466415 1:165078384-165078406 GAGACCAATGGGTCTTCAGGAGG + Intergenic
918928321 1:190816913-190816935 GATACTGATGTACCTACAGCTGG - Intergenic
920510810 1:206550767-206550789 GAGGATAATGTGTCTACAGAGGG - Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923264147 1:232297022-232297044 GAGAATGTTCTGTCTAAAGGTGG + Intergenic
924312823 1:242763606-242763628 CAAACTGATGTTTCTGCAGGGGG - Intergenic
1062920059 10:1272885-1272907 GAGACTGAGGTGTCCAGGGGCGG + Intronic
1065455225 10:25900106-25900128 GAGACTAAGCTGCCTACAGGAGG - Intergenic
1067150271 10:43726780-43726802 GAGACTGAGATGTCCAAAGGAGG + Intergenic
1070063611 10:73011015-73011037 ATGAGTGATGTGTCTGCAGGAGG - Exonic
1070163370 10:73879756-73879778 GGTACTGATGTGACGACAGGCGG + Intergenic
1070828917 10:79406932-79406954 GAGACTGGGGTGTGTAAAGGTGG - Intronic
1071089069 10:81897975-81897997 GAGACTGATTGGTCTACAGTGGG - Intronic
1072506976 10:96077891-96077913 GAGAGTGATTTGGCTATAGGTGG - Intergenic
1077417583 11:2432027-2432049 GAGACGGAGGTGTCTAGGGGAGG + Intergenic
1077545988 11:3170217-3170239 GAGGCTGAGGTGGCTCCAGGGGG + Intergenic
1082621918 11:55433464-55433486 GAGAATGATGTGAATCCAGGAGG + Intergenic
1083624844 11:64067171-64067193 GAGCCGCATGTGCCTACAGGTGG - Intronic
1089338874 11:117744445-117744467 GAGACTGATGCGTATCCATGAGG - Intronic
1093675542 12:21935302-21935324 AAGACTGATGTTTCTACATATGG + Intronic
1093748669 12:22772936-22772958 AAGACTGCTTAGTCTACAGGGGG - Intergenic
1094281588 12:28746008-28746030 GACTCTGATGTGTCTACGAGTGG + Intergenic
1099755482 12:86842255-86842277 GAGACTGACTTGACTACATGAGG + Intergenic
1101535265 12:105610697-105610719 GATAATGGGGTGTCTACAGGGGG + Intergenic
1104664053 12:130634903-130634925 GAAAATGATTTGTTTACAGGTGG - Intronic
1105278788 13:18951338-18951360 GAGACTGTTGTTTTTTCAGGTGG - Intergenic
1105806925 13:23957571-23957593 GAGACTGATGTGTGAGCAGGAGG - Intergenic
1107357339 13:39582130-39582152 GAGACTGATGTGTCTACAGGAGG - Intronic
1107840815 13:44455612-44455634 TAGACAGATGATTCTACAGGAGG - Intronic
1109274240 13:60286332-60286354 TAGAGTGATGTCTCCACAGGGGG + Intergenic
1109278825 13:60331895-60331917 GAGAGTGCTCTGTCTCCAGGAGG + Intergenic
1113683347 13:112260602-112260624 AAGACAGATGTGTGTGCAGGTGG + Intergenic
1124478510 15:30058058-30058080 AAGGCTGATGTGTCTACAGGGGG + Intergenic
1130342751 15:83013080-83013102 GAGATTGAGTTCTCTACAGGAGG + Intergenic
1131866905 15:96721010-96721032 GAGACTCATGTGTAAACAGAAGG + Intergenic
1136405323 16:30042530-30042552 GGGATTGATGTGTATAAAGGCGG - Intronic
1143998015 17:11025152-11025174 GAGCTTGATGTGTCTACGAGAGG + Intergenic
1144382582 17:14717433-14717455 GAGACTGAGGTGGCTACTGTTGG + Intergenic
1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG + Intronic
1146794885 17:35773913-35773935 CAGAGTGAAGTGTCTAGAGGTGG - Intronic
1147455462 17:40535279-40535301 CAGACTCTTGTGTCTGCAGGAGG + Intergenic
1154140654 18:11821750-11821772 GATACTGATATTTCTGCAGGAGG + Intronic
1154954974 18:21244188-21244210 GAAACTGGTGTGTGTGCAGGAGG - Intronic
1156830629 18:41486735-41486757 GTGACTGATGATTCTACATGGGG + Intergenic
1157272296 18:46285428-46285450 GAAAGTGATGTGTGAACAGGGGG + Intergenic
1158713442 18:59857677-59857699 GACACTGAGGAGTCTACAGAGGG - Intergenic
1160541119 18:79623610-79623632 GGGACTGAGGTGTATACAGTAGG + Intergenic
1162046582 19:8004630-8004652 GAGAATGATCTGTCTAGAGCAGG - Intronic
1162336996 19:10067917-10067939 AAGCCTGGTGTGGCTACAGGAGG + Intergenic
1165527699 19:36370062-36370084 CAAACTGATGTTTCTGCAGGTGG - Intronic
1166563979 19:43752320-43752342 TAGACTGATGTGTGAACAGCTGG - Intronic
1166642150 19:44502610-44502632 GATACTGATGTGTAGACAAGCGG - Intronic
1167028362 19:46939150-46939172 GAGACCCCTGTGTCTACAGCAGG - Intronic
925807667 2:7667103-7667125 GAAACTGATGTATCTACAGAAGG - Intergenic
926005836 2:9372988-9373010 GGGCCTGTTGTGCCTACAGGTGG + Intronic
926291511 2:11534886-11534908 GGGAGTGTTGTGTCCACAGGGGG + Intronic
935637276 2:105259041-105259063 GATAATGATGGGTTTACAGGAGG + Intergenic
935869440 2:107429230-107429252 GAGATAGATGACTCTACAGGGGG + Intergenic
937201264 2:120205864-120205886 GAGACTGGTGTCTTTATAGGAGG + Intergenic
938003034 2:127761288-127761310 GAGACTGGTGTGAATCCAGGTGG - Intronic
942161599 2:173194712-173194734 GTGACTGCTGTGTGTAGAGGGGG - Intronic
942306784 2:174616331-174616353 GAGAATCATGTGTCTATAAGAGG + Intronic
942512990 2:176722671-176722693 AAGACTGCTGTGTCTGCAGTGGG + Intergenic
942656370 2:178218265-178218287 GAGGCTGACTTGTCTACAGATGG - Intronic
943847798 2:192674123-192674145 GAAAATGATGTATCTACAAGGGG - Intergenic
945301891 2:208222154-208222176 GAGACTGGTGTTACTACAGGAGG - Intergenic
948358829 2:237403459-237403481 GAGACTGCTGTATTGACAGGTGG - Intronic
948517329 2:238511895-238511917 GAGAGTGATGTGTATCCAGAAGG + Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1169769135 20:9182380-9182402 CAGGCTGAAGTGTCTACGGGAGG + Intronic
1172522503 20:35577107-35577129 GAGACTGAGGTGACTACTTGAGG + Intergenic
1173768741 20:45639352-45639374 GAGAATGATGTGAATCCAGGAGG - Intergenic
1174774226 20:53329215-53329237 GAGACTGTTTTGTCTAGAGCAGG + Intronic
1177333197 21:19688047-19688069 GAGAATGATGTGAATCCAGGAGG - Intergenic
1178366405 21:31992291-31992313 GAGACGGAGATGCCTACAGGAGG - Intronic
1179391026 21:40991006-40991028 CAAACGGATGTTTCTACAGGGGG + Intergenic
1181659069 22:24327825-24327847 GAGACAGATGTGTCGAGATGTGG + Intronic
949739424 3:7213557-7213579 GACACAGATGTATATACAGGAGG + Intronic
950626219 3:14249057-14249079 GAGACTGATTTGTCTCCTGAGGG - Intergenic
951624545 3:24645209-24645231 GAGACGTGTGTGTCCACAGGGGG + Intergenic
955583062 3:60445696-60445718 GAAAATCGTGTGTCTACAGGGGG - Intronic
956140138 3:66138330-66138352 GAGTGTGATGTGTCTGAAGGGGG - Intronic
956720269 3:72111167-72111189 GCGACTGCTCTGCCTACAGGTGG - Intergenic
957881407 3:86218534-86218556 GAGAATGAAGTGAATACAGGAGG - Intergenic
961816970 3:129556094-129556116 GAGACTGATCTGGGGACAGGTGG + Exonic
962933491 3:140058881-140058903 GAGGCTGCTGTGTTTCCAGGAGG + Intronic
963070930 3:141304578-141304600 GAGACAGACGTGTGTGCAGGGGG - Intergenic
966677973 3:182609805-182609827 GAGAATTATGTGTGTACGGGTGG - Intergenic
967265497 3:187687688-187687710 GAGAGTGGTGTGTCTAAAGAGGG + Intergenic
970168345 4:13263283-13263305 GAGAATGATGTGAATCCAGGAGG + Intergenic
971173316 4:24256641-24256663 GCTACTGCTGTGTCTACAGGAGG + Intergenic
972410097 4:38784929-38784951 CAGATGGATTTGTCTACAGGAGG + Intergenic
975594897 4:76040694-76040716 GACAAAGATGTGTCTACATGGGG - Intronic
978353838 4:107849197-107849219 TAGAGAGCTGTGTCTACAGGAGG + Intronic
985342908 4:188973771-188973793 GGGAATGATGTCCCTACAGGCGG + Intergenic
985342961 4:188973930-188973952 GGGAATGATGTCCCTACAGGTGG + Intergenic
985343068 4:188974250-188974272 GGGAATGATGTCCCTACAGGTGG + Intergenic
985343082 4:188974295-188974317 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343170 4:188974568-188974590 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343183 4:188974613-188974635 GGGAATGATGTCCCTACAGGTGG + Intergenic
985343205 4:188974681-188974703 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343225 4:188974749-188974771 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343281 4:188974909-188974931 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343361 4:188975138-188975160 GGGAATGATGTCCCTACAGGCGG + Intergenic
985343401 4:188975252-188975274 GGGAATGATGTCCCTACAGGCGG + Intergenic
1000234034 5:159341143-159341165 GAGAGTGATGTGATTCCAGGGGG + Intergenic
1005885473 6:30094288-30094310 GAGATTGTTCTGTCTGCAGGTGG + Intergenic
1007082834 6:39120784-39120806 GATAATGATGTGTCTAGAGCAGG + Intergenic
1007292491 6:40798164-40798186 GAGACAGACCTGTCTACAAGAGG + Intergenic
1008656387 6:53618363-53618385 GAAAGTGATGTGTTCACAGGTGG - Intergenic
1017368098 6:153668964-153668986 GAGACTGATGAGTCAACTGTGGG - Intergenic
1018473566 6:164118539-164118561 GAGACAGATGTGTAAACAGATGG + Intergenic
1019644918 7:2124013-2124035 GAGCCTGACCTGGCTACAGGGGG - Intronic
1019983862 7:4641483-4641505 AGGACTGATGTGTCTCGAGGGGG + Intergenic
1020803421 7:12759826-12759848 GAGAATGATGTGTCTCCTGTTGG + Intergenic
1021428437 7:20530997-20531019 GAGAATCATGTATTTACAGGAGG - Intergenic
1022000450 7:26221155-26221177 GATACTGATCTTTCCACAGGTGG + Intergenic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1029527876 7:101106340-101106362 GGGACAGATGTGTCTCCAAGTGG - Intergenic
1029689778 7:102173627-102173649 CATTCTGATGTGTCTACACGGGG + Intronic
1034219947 7:149436452-149436474 GACACTGATGGGGCAACAGGTGG - Intronic
1035929764 8:3767127-3767149 GAGGCTGCTGTGTCTCCAGCTGG + Intronic
1036483601 8:9159825-9159847 GGGACTGAAGTTTCTGCAGGCGG - Intronic
1040892027 8:52327072-52327094 GTGAGTGATTTGGCTACAGGAGG - Intronic
1042482424 8:69319281-69319303 GAGACAGGTGTGACTACAGAAGG - Intergenic
1044281441 8:90361722-90361744 GTGACTCATGTGTATGCAGGTGG - Intergenic
1045526985 8:102949304-102949326 GAGACTGATGGGTGAACAGTTGG - Intronic
1048608065 8:135990711-135990733 TGGACTGAGGTGTCTACATGAGG + Intergenic
1049962153 9:747189-747211 GAGAGGGATGTGCCTCCAGGTGG - Intergenic
1050230196 9:3516136-3516158 GAGAATGGTGTGAATACAGGAGG - Intronic
1050338647 9:4614075-4614097 GAGAATGATGAGTCAACAGATGG + Intronic
1052080018 9:24193058-24193080 GAAACTGATGTGCCTAGAAGGGG + Intergenic
1053542968 9:38993766-38993788 TAGGCTGATGTGTGTACATGGGG + Intergenic
1053577314 9:39365491-39365513 GAGAAGGACGTGTCAACAGGTGG - Intergenic
1053807411 9:41817283-41817305 TAGGCTGATGTGTGTACATGGGG + Intergenic
1053841813 9:42193416-42193438 GAGAAGGACGTGTCAACAGGTGG - Intergenic
1054098882 9:60924181-60924203 GAGAAGGATGTGTCAACAGGTGG - Intergenic
1054120280 9:61199802-61199824 GAGAAGGATGTGTCAACAGGTGG - Intergenic
1054587471 9:66982752-66982774 GAGAAGGACGTGTCAACAGGTGG + Intergenic
1054623181 9:67370144-67370166 TAGGCTGATGTGTGTACATGGGG - Intergenic
1058656853 9:107230321-107230343 GAGAGGGATGAGGCTACAGGAGG + Intergenic
1060468888 9:123930765-123930787 GGGACTGTTGTGTTAACAGGAGG - Intergenic
1062360021 9:136183218-136183240 GACACTAATGTGTCTCCAAGGGG - Intergenic
1191956808 X:66651184-66651206 CAAACTGATGTTTCTACAAGAGG - Intergenic
1194238068 X:91409304-91409326 GAGACTGGTGTGAATCCAGGAGG + Intergenic
1198287840 X:135210070-135210092 CACATTGATGTTTCTACAGGAGG + Intergenic
1200312361 X:155090852-155090874 GAGACTTATGTGTGTATTGGAGG + Intronic
1200875350 Y:8148567-8148589 GAGAATGATATGACCACAGGAGG + Intergenic