ID: 1107359616

View in Genome Browser
Species Human (GRCh38)
Location 13:39603781-39603803
Sequence CTGCCTTTCCAGACGAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107359611_1107359616 5 Left 1107359611 13:39603753-39603775 CCAAGGCTCATGTATGGCATGGG 0: 1
1: 0
2: 1
3: 13
4: 112
Right 1107359616 13:39603781-39603803 CTGCCTTTCCAGACGAGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1107359609_1107359616 6 Left 1107359609 13:39603752-39603774 CCCAAGGCTCATGTATGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1107359616 13:39603781-39603803 CTGCCTTTCCAGACGAGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107359616 Original CRISPR CTGCCTTTCCAGACGAGCCA GGG Intergenic
901538990 1:9902547-9902569 TTGGCTTTCCAGAAGAGCAAGGG - Intronic
906574366 1:46874679-46874701 CTTCCTTTCCATATGACCCAGGG - Intergenic
906597605 1:47093225-47093247 CTTCCTTTCCATATGACCCAGGG + Intronic
907419224 1:54335696-54335718 CTGCCTGTCCTCAGGAGCCAGGG + Intronic
910602747 1:89049474-89049496 CTGCATTTCAAGTTGAGCCAAGG + Intergenic
910637965 1:89429767-89429789 CTGCATTTCAAGTTGAGCCAAGG - Intergenic
912609533 1:111029135-111029157 CTTCCTTTCCATATGACCCAGGG - Intergenic
915038356 1:152947244-152947266 CTACCTTTCCAGACTTACCAAGG - Intergenic
922524012 1:226283655-226283677 CTGCTTTTCCAGGCCAGGCATGG + Intronic
1065738946 10:28779440-28779462 CTGCCTTTCAGGAGGAGCTATGG - Intergenic
1066506330 10:36048657-36048679 CTACCTTTCCAGCTGAGACAAGG + Intergenic
1067568160 10:47352744-47352766 CTTCCTTTCCAGTATAGCCAAGG + Intronic
1069303374 10:66937022-66937044 GGGCCTTTCCAAAGGAGCCAAGG + Intronic
1070897407 10:79996478-79996500 CTGCCTTGCCAGACAAGGCTTGG - Intergenic
1071368107 10:84922133-84922155 ATGGCTTGCCAGAGGAGCCAAGG + Intergenic
1075727127 10:124616389-124616411 CTGACTTTCCGGCTGAGCCAGGG + Intronic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1084615195 11:70231250-70231272 CTGCCTGCACAGAGGAGCCAGGG + Intergenic
1084893755 11:72250579-72250601 CTTCCTTTCCAGACGGCACAGGG - Intergenic
1085561567 11:77476586-77476608 CTTCCTTTCCAGAGGCTCCAAGG - Intergenic
1085597456 11:77822229-77822251 CTGCAGTTCCAGACCAGCCTGGG + Intronic
1097393198 12:59040750-59040772 CTGCCTTCCCAGAGGAGAGAAGG + Intergenic
1099558425 12:84141652-84141674 CAGTCTTTCCTGACAAGCCATGG - Intergenic
1103796551 12:123506967-123506989 CTGCCTCTGCACACCAGCCAGGG - Intronic
1104288522 12:127447283-127447305 CTGCTTTTCCAGACAAGCATAGG + Intergenic
1104786798 12:131455459-131455481 CTCCCTGTCCAGAGCAGCCATGG - Intergenic
1104800641 12:131553318-131553340 CTGCCTTTTCAGACGATATAGGG + Intergenic
1107359616 13:39603781-39603803 CTGCCTTTCCAGACGAGCCAGGG + Intergenic
1117290446 14:54327014-54327036 CTGCCTCCCCTGCCGAGCCATGG + Intergenic
1120786081 14:88538211-88538233 CTGCCTTTCGTGATGAGCCCAGG - Intronic
1125348374 15:38742404-38742426 CTCCCATTCCTGACCAGCCATGG + Intergenic
1125630406 15:41142461-41142483 CTGGAGTTCCAGACCAGCCACGG + Intergenic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1127096341 15:55515372-55515394 CTGACTTTCAGGACCAGCCATGG - Intergenic
1127502028 15:59562627-59562649 CTACCATTACAGACCAGCCAGGG - Intergenic
1129784483 15:78300092-78300114 CTGGGTTTCCAGACCAGCCTGGG + Intergenic
1133269385 16:4603020-4603042 CAGGATTTCCAGACCAGCCAGGG + Intergenic
1134183201 16:12063854-12063876 CTGCATTTCTAGACCATCCATGG + Intronic
1134188870 16:12106010-12106032 CTGTCCCTCCAGAGGAGCCACGG - Intronic
1137452862 16:48593166-48593188 CTGACTTTCCAGCATAGCCAGGG - Intronic
1141445521 16:84055414-84055436 AGGCCTTTCCAGCCGAGCCTGGG - Intronic
1141896011 16:86959238-86959260 GTGGCTTTCCAGGCCAGCCAGGG + Intergenic
1145795172 17:27651286-27651308 CAGCCATTTCAGAGGAGCCATGG + Intergenic
1145809625 17:27756637-27756659 CAGCCATTTCAGAGGAGCCATGG + Intergenic
1150276412 17:63900626-63900648 CTGTTTTTGCAGACAAGCCATGG + Intergenic
1152086494 17:78222620-78222642 GTGCCTTTGCACACCAGCCAAGG + Intronic
1152411544 17:80126589-80126611 CTTCCTTTCCAGAAGCTCCAGGG + Intergenic
1157228621 18:45891976-45891998 CTGTCTCTCCAGGCCAGCCAGGG - Intronic
1158207595 18:55010836-55010858 CTGTGTTTCCAGAGAAGCCATGG + Intergenic
1162606183 19:11709871-11709893 CTGCCTTTCCAGCACTGCCATGG + Intergenic
1162745350 19:12794743-12794765 CAGCAGTTCCAGACCAGCCAGGG - Intronic
1162773969 19:12967619-12967641 CTGCTTTTCAAGACCAGCCTGGG + Intronic
1163161793 19:15469340-15469362 CTACCTTTCCAGCCAAGGCATGG - Intronic
1163471516 19:17500132-17500154 CTGCTTTTGCAGATCAGCCAAGG + Intronic
935112533 2:100105553-100105575 CTGCCTTTCCAGACCGGAGACGG - Exonic
935737313 2:106116522-106116544 CTGCCTGTCCAGATAAGCCCAGG + Intronic
938401537 2:130996232-130996254 CTGCCTTGCCTGGGGAGCCAGGG - Intronic
941747028 2:169097802-169097824 CTGACTTTCCAGACCTCCCAGGG + Intergenic
946295582 2:218781580-218781602 CTGCCTTGGCAGACGCGGCAGGG + Intergenic
946891816 2:224284439-224284461 ATGTCTTTGCAGACAAGCCAAGG - Intergenic
947461336 2:230306824-230306846 CTGCCTTTCCCCACCACCCATGG - Intronic
948127282 2:235573753-235573775 CTGACTCTCCAGATGAGCCGGGG - Intronic
948621031 2:239234767-239234789 CTGCCTGTCGAGACCTGCCATGG - Intronic
948826925 2:240577404-240577426 CTGCCCTTCCAGGCCAACCATGG - Intronic
1172614482 20:36274440-36274462 CTGCGTTTCCATAGGAACCAGGG + Intergenic
1172763273 20:37336725-37336747 TTTCCTTTCCAGATGAGCCCTGG + Intergenic
1174448551 20:50606489-50606511 CTCCCTTTCCATCTGAGCCATGG - Intronic
1176235354 20:64051169-64051191 CTGCCTCCCCAGAAAAGCCAGGG - Intronic
1179666527 21:42916628-42916650 CCACCTTTCCAGAAGAACCAAGG + Intergenic
1182172965 22:28252089-28252111 CTGCCTTTCCAGAACAGCCCTGG + Intronic
1182269689 22:29145591-29145613 CTGCCTTCTCAGAAGGGCCAAGG - Intronic
1182548384 22:31088545-31088567 CTGCCCTGCCAGCCGTGCCAGGG - Exonic
1185368466 22:50447610-50447632 CTGCATTTCCAGCAGAACCAGGG + Intronic
950465093 3:13148905-13148927 CATCCTTTCCAGGGGAGCCAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953771788 3:45783117-45783139 CTCCCATTCCACACCAGCCAGGG - Intronic
955494692 3:59519335-59519357 CTCCCTTTCCATCCGAGCCATGG + Intergenic
960803599 3:121562166-121562188 CTCCCTTTCAACACAAGCCATGG + Intergenic
962928779 3:140018732-140018754 CTGCATTTCCAAACGAGGGAGGG + Intronic
965134458 3:164744033-164744055 CTGAAGTTCCAGACCAGCCAGGG - Intergenic
967807374 3:193727839-193727861 CTGGCTTTACAAACGAGCCCTGG + Intergenic
968584902 4:1411792-1411814 CTCCCCTTCCAGAAGTGCCAGGG + Intergenic
975310530 4:72898545-72898567 CTGCCTTTCTGTAAGAGCCAGGG + Intergenic
975665365 4:76729625-76729647 CTGACTTTCTAGATGAGCAAAGG + Intronic
975699973 4:77055204-77055226 CTCCATTTCCAGACTAACCATGG + Exonic
982042672 4:151410401-151410423 CAGCCCTTCCAGAGAAGCCAAGG - Intronic
982046768 4:151455503-151455525 ATGCCTTTCCAAAGGAACCATGG + Intronic
986235308 5:5904226-5904248 CTGCCCTGCAAGACCAGCCAAGG + Intergenic
989642170 5:43593465-43593487 AAGCCTTTCCAGACCATCCAAGG - Intergenic
990705318 5:58522124-58522146 ATACCTTTTCAGACCAGCCAAGG + Intergenic
992883111 5:81130355-81130377 CTGCCTTCACAGCAGAGCCATGG - Intronic
995325355 5:110883431-110883453 CTGACTTTCCAGCATAGCCATGG - Intergenic
997732938 5:136193790-136193812 TCGCCTTTCCAGACCTGCCAAGG - Intergenic
997846452 5:137290841-137290863 CTGGCTTTCCAGACCTGTCAGGG - Intronic
998046323 5:138989990-138990012 ATGCCTTTCCCAAAGAGCCATGG - Intronic
998581350 5:143379434-143379456 CTGCCTTTCCACCAGAGGCAAGG + Intronic
999753372 5:154646842-154646864 CTTCCTTTCCCGAGGAGCGACGG - Intergenic
1002664244 5:180810820-180810842 CTGCCTCTCTTGACGAGGCAGGG + Intronic
1003851203 6:10224366-10224388 CTGAATATCCTGACGAGCCAGGG + Intergenic
1005742658 6:28806970-28806992 CAGGATTTCCAGAAGAGCCAGGG + Intergenic
1006838651 6:37014502-37014524 CTGCCTGTGCAGCCCAGCCATGG - Intronic
1007662684 6:43496335-43496357 CTGCCCCTCCAGAGGAGCCCGGG - Intronic
1017049000 6:150372826-150372848 CTCCCTTTGCAAACCAGCCAAGG + Intronic
1017465998 6:154694340-154694362 CTGGAGTTCCAGACCAGCCAGGG - Intergenic
1017823144 6:158063294-158063316 CTGCCTTTCCAGAAGTGCTGGGG + Intronic
1018396042 6:163378761-163378783 CAGCATTTCCAGACCAGCCTGGG + Intergenic
1019911762 7:4105023-4105045 GTGCCTCTCCACACCAGCCAGGG - Intronic
1023071717 7:36441473-36441495 CTTCCTTTCCTGATGTGCCAGGG + Intronic
1024960050 7:54964584-54964606 GTGCCTTTACAGAAGAGCCCAGG + Intergenic
1026501448 7:70946487-70946509 CTCCCTTCCCAGAGGAGCCTTGG + Intergenic
1030059466 7:105611278-105611300 CTGCCTTTGCAGACTAGACAGGG - Intronic
1030196794 7:106860517-106860539 CAGGCGTTCCAGACCAGCCAGGG + Intergenic
1035060305 7:156064090-156064112 CTTCCTTTTCAGATGTGCCAGGG - Intergenic
1039495836 8:37979382-37979404 CTGGCATTCCAGACCAGCCTAGG + Intergenic
1040288529 8:46112582-46112604 CTTCCATTCCAGAAGAGCCCAGG - Intergenic
1041080170 8:54208234-54208256 CTGCCTCTCCAGCAGGGCCAGGG - Intergenic
1042360966 8:67882625-67882647 CTGACTTTCCAAAAGAGCAAAGG + Intergenic
1044439483 8:92206971-92206993 CTGACTCTCCAGACTAGCTAGGG + Intergenic
1044628972 8:94261045-94261067 GTGCCTGTCCAGTCCAGCCAGGG - Intronic
1049168386 8:141141371-141141393 GTGCCTCTCCAGGTGAGCCAAGG + Intronic
1050119644 9:2295351-2295373 CTGCCTTTCCGGTGTAGCCAAGG - Intergenic
1051210830 9:14741301-14741323 CTGCTTTTCCAGACTAGATATGG + Intronic
1056944788 9:90985026-90985048 CAGGAGTTCCAGACGAGCCAGGG + Intergenic
1057329298 9:94097876-94097898 CCGCCTTTTCAGATGAGTCAGGG - Exonic
1059324101 9:113493138-113493160 CTGCCATTCCAGAAAAGCCTTGG - Intronic
1061568092 9:131457652-131457674 CTCCTTTTCCAGACCATCCATGG + Intronic
1062133925 9:134914774-134914796 CTGCCTTTCCAGGGGCTCCAGGG + Exonic
1189350698 X:40273512-40273534 CTTCCTTCCCAGCTGAGCCAGGG + Intergenic
1190939191 X:55024578-55024600 CAGTCTTTCCAGGGGAGCCATGG - Intronic
1191204634 X:57821179-57821201 CTTCCTTTCCATATGACCCAGGG + Intergenic
1198984857 X:142438769-142438791 CCGCCTTTCCACACCAGCCTGGG + Intergenic
1199969952 X:152852431-152852453 CTGCCTGTCCAGAGTAGCAAGGG + Intronic