ID: 1107364446

View in Genome Browser
Species Human (GRCh38)
Location 13:39655619-39655641
Sequence CCGCGCATGCGCATCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107364446_1107364450 16 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1107364446_1107364451 27 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107364446 Original CRISPR CCGCGCATGCGCATCGGCCC CGG (reversed) Intronic