ID: 1107364446

View in Genome Browser
Species Human (GRCh38)
Location 13:39655619-39655641
Sequence CCGCGCATGCGCATCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107364446_1107364451 27 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 316
1107364446_1107364450 16 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107364446 Original CRISPR CCGCGCATGCGCATCGGCCC CGG (reversed) Intronic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
906326678 1:44850497-44850519 CCACGCCTGAGCATCAGCCCAGG - Intergenic
916786335 1:168089746-168089768 CTGCCCATGCGCCTCTGCCCAGG + Intronic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1072562238 10:96586914-96586936 CCGTGGATGCGAATCGGCCGCGG - Exonic
1087634406 11:100687046-100687068 CCGCGCTTGCGCTCCGGCCTTGG - Intergenic
1094820306 12:34219244-34219266 CCGCTCATGCCCACCGGACCCGG - Intergenic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG + Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1094847844 12:34369185-34369207 CCGCACATGCGCATGGCCCAGGG - Intergenic
1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG + Intergenic
1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG + Intergenic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1105927171 13:25018592-25018614 CCGGGCATGGGCTTCGGCCCAGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107534064 13:41311215-41311237 CCGCGCATGCGCACAGGATCCGG + Exonic
1113640604 13:111954276-111954298 CTGTGCATGGGCATTGGCCCAGG - Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG + Intronic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG + Intronic
1148621088 17:49035486-49035508 CCTCGCATCCGCATCTGCCCAGG - Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG + Intronic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1161925338 19:7294915-7294937 CCGCGAGTGCGCCCCGGCCCAGG + Intergenic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1165296142 19:34927292-34927314 TCGCGGATGCACACCGGCCCCGG - Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932355936 2:71068540-71068562 CCGCGCATGCGCACGCGCACAGG + Exonic
934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG + Intergenic
934636292 2:95992379-95992401 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
934836054 2:97590392-97590414 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
1176234851 20:64049444-64049466 CCGCGACTGTGCATGGGCCCCGG - Exonic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
953564793 3:44022145-44022167 CCGCCCTTGCGCATCCGGCCCGG - Intergenic
954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG + Intergenic
957048807 3:75396257-75396279 CCGGGCATGGGCTTCGGCCCGGG - Intergenic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
984594977 4:181656526-181656548 CCGCGGATGCAGATGGGCCCAGG + Intergenic
988264139 5:28928146-28928168 CCGGGCATGGGCTTTGGCCCGGG - Intergenic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG + Exonic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1049208186 8:141373057-141373079 CCGGGCAGGCGCCTGGGCCCAGG - Intergenic
1049756350 8:144312797-144312819 CCGGGCATGAGCGTCGGGCCTGG + Intronic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG + Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1200053030 X:153444780-153444802 ACGGGCCTGCTCATCGGCCCAGG + Exonic