ID: 1107364450

View in Genome Browser
Species Human (GRCh38)
Location 13:39655658-39655680
Sequence CAATACTCGCGCTGCCTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107364446_1107364450 16 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1107364445_1107364450 29 Left 1107364445 13:39655606-39655628 CCGGCGAAGACTTCCGGGGCCGA 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1107364444_1107364450 30 Left 1107364444 13:39655605-39655627 CCCGGCGAAGACTTCCGGGGCCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1107364448_1107364450 10 Left 1107364448 13:39655625-39655647 CCGATGCGCATGCGCGGCCGATT 0: 1
1: 0
2: 1
3: 1
4: 12
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1107364449_1107364450 -7 Left 1107364449 13:39655642-39655664 CCGATTTGCACATGCGCAATACT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107364450 Original CRISPR CAATACTCGCGCTGCCTCCG TGG Exonic
903790851 1:25891921-25891943 CAATACTCATGCAGCCTGCGAGG + Intronic
903917619 1:26775580-26775602 CATTACCCGCCATGCCTCCGGGG - Exonic
904248233 1:29203422-29203444 CAACACTCACGATGCCTCCCAGG + Intronic
912746209 1:112247635-112247657 CAATCATCGCCCTGCCTCTGAGG + Intergenic
919389442 1:196963761-196963783 CACTACAAGCTCTGCCTCCGGGG - Intergenic
920034643 1:203058059-203058081 CAATGCTCCCACTGCCTCAGGGG - Intronic
1063523769 10:6764364-6764386 CAGAACTAGCGCTGCCTCTGTGG - Intergenic
1082024335 11:47561060-47561082 CAATACAAGCTCTGCCTCCCGGG - Intronic
1083959005 11:66003509-66003531 CAAAACCCGCGCTGCTTCCTGGG + Intronic
1085478745 11:76804943-76804965 CAATGCTACCTCTGCCTCCGGGG + Intergenic
1093030644 12:14285552-14285574 CACTACAAGCGCTGCCTCCCGGG + Intergenic
1106411607 13:29514902-29514924 CGATACTCTCGTGGCCTCCGGGG - Intronic
1107364450 13:39655658-39655680 CAATACTCGCGCTGCCTCCGTGG + Exonic
1109823533 13:67688137-67688159 CACTACTAGCTCTGCCTCCCAGG - Intergenic
1122951366 14:105047006-105047028 CAAAACTCTCCCTGCCTCCCTGG + Intergenic
1124652602 15:31484535-31484557 CAAGACGCGCGCCGACTCCGTGG - Exonic
1147009046 17:37428968-37428990 CAATACAAGCTCTGCCTCCCGGG - Intronic
1148932806 17:51140757-51140779 CAATCCTCCCTCTGCCTCCCAGG - Intergenic
1150106685 17:62467456-62467478 CACTACACGCTCTGCCTCCCGGG - Intronic
1151323513 17:73365462-73365484 CAATACTCCCGCTAGCTCCTTGG - Intronic
1151756151 17:76076364-76076386 CCATTCTCCCGCTGCCCCCGGGG - Intronic
926416199 2:12651941-12651963 CTGCACTCGCGCTGCCTCCCTGG - Intergenic
928524471 2:32125868-32125890 CAATACACGCTCCGCCTCCCGGG + Intronic
940869541 2:158848527-158848549 GAATTCGCGCGCTGCCTCAGAGG + Intronic
944235907 2:197441258-197441280 CAATGCAAGCTCTGCCTCCGGGG - Intergenic
1179351345 21:40614093-40614115 CAATCCTGGCACTGCCCCCGGGG + Intronic
1181302721 22:21892890-21892912 CACTACAAGCGCTGCCTCCCGGG - Intergenic
950886132 3:16364539-16364561 CCATACTCTCTCTGCCTCGGTGG + Intronic
961275131 3:125720430-125720452 GAATTCTCGCGCTGACTCAGAGG + Intergenic
961972635 3:130986668-130986690 AAATACTAGCCCTGCCTCCCAGG + Intronic
980753504 4:137124910-137124932 CAATATTCGTGCTGCATTCGAGG - Intergenic
988322627 5:29718629-29718651 CACTACTAGCTCTGCCTCCCAGG - Intergenic
988484031 5:31653523-31653545 CATAACTAGCGCTGCCTCAGAGG - Intronic
999660968 5:153862504-153862526 CACTCCTCGCTCTGCCTCTGTGG + Intergenic
1012539136 6:100340126-100340148 CAATACTGCTGCTGCCTCTGTGG + Intergenic
1019353123 7:564410-564432 CAATCCTGGCCCTGTCTCCGTGG + Intronic
1019412389 7:911967-911989 AAAGCCTCGCGCTGCCTGCGAGG + Intronic
1041578606 8:59430052-59430074 CAAATCTCGCTCTGCCTCCCAGG - Intergenic
1053434392 9:38065914-38065936 CAATAATGGCCCTGCCTCCAAGG + Intronic
1199431555 X:147766674-147766696 CACTACTAGCTCTACCTCCGTGG + Intergenic