ID: 1107364451

View in Genome Browser
Species Human (GRCh38)
Location 13:39655669-39655691
Sequence CTGCCTCCGTGGTCCCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107364446_1107364451 27 Left 1107364446 13:39655619-39655641 CCGGGGCCGATGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 316
1107364448_1107364451 21 Left 1107364448 13:39655625-39655647 CCGATGCGCATGCGCGGCCGATT 0: 1
1: 0
2: 1
3: 1
4: 12
Right 1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 316
1107364449_1107364451 4 Left 1107364449 13:39655642-39655664 CCGATTTGCACATGCGCAATACT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG 0: 1
1: 0
2: 5
3: 38
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107364451 Original CRISPR CTGCCTCCGTGGTCCCTGCC TGG Exonic
900103933 1:974253-974275 CCGCCTCCAAGCTCCCTGCCTGG + Intronic
900255813 1:1697805-1697827 CGGCATCCACGGTCCCTGCCGGG - Intronic
900264484 1:1750415-1750437 CGGCATCCACGGTCCCTGCCGGG - Intergenic
900286198 1:1901763-1901785 CTGCCCTCTTGGGCCCTGCCAGG + Intergenic
900973858 1:6005807-6005829 CAGCACCCGTGGTCCCTGCCAGG - Intronic
901059406 1:6465231-6465253 CTGCCTGCCTGACCCCTGCCTGG - Intronic
902236470 1:15060574-15060596 CTGCCCCAGTGGGCCCTGTCTGG + Intronic
902771962 1:18650338-18650360 CTGCCTCTTCAGTCCCTGCCCGG + Intronic
903535346 1:24063037-24063059 CTCCCTCCCTTCTCCCTGCCTGG - Intronic
903695861 1:25206451-25206473 CTGCCTCAGTGTGTCCTGCCAGG - Intergenic
904467571 1:30717577-30717599 GGCCCTCCTTGGTCCCTGCCAGG + Intronic
904496830 1:30891911-30891933 GATCCTCTGTGGTCCCTGCCTGG - Intronic
904833672 1:33321241-33321263 CTGCCTGCGAGGGACCTGCCGGG + Intergenic
905107516 1:35573383-35573405 CTGCCTCCATGGACCCGCCCGGG + Exonic
905262742 1:36730926-36730948 GGGCCTCTGTGGCCCCTGCCAGG - Intergenic
905656273 1:39688067-39688089 CTGAATCCGTGCTACCTGCCTGG + Intronic
906240187 1:44238064-44238086 CTGCCTCCGTGCTGGCTGCCTGG - Intronic
907161718 1:52375705-52375727 CTTCCTCCAGGTTCCCTGCCAGG - Intronic
912684149 1:111748882-111748904 CTGCCTCCTTGTTCCCTCCAGGG - Intronic
915251013 1:154588509-154588531 CTGCCAGGGTGGGCCCTGCCAGG - Intronic
915498624 1:156299129-156299151 CTGCCTCCTGGGTGCCCGCCTGG + Exonic
915636381 1:157189891-157189913 CTGCCTCCCTGGCTCCAGCCTGG - Intergenic
915733201 1:158068538-158068560 CTGCCTCCATGGCCCTTGCCAGG + Intronic
918852201 1:189706964-189706986 CTGCCTCTTTGGTCCCAGGCTGG - Intergenic
919761182 1:201099205-201099227 CTGCCTCTGTGGTCCCAGATAGG - Intronic
920381527 1:205537172-205537194 CTGCATCCCTGGGCCCTTCCTGG + Intergenic
920436545 1:205950508-205950530 CTGCCTCTGAGCTCCCTGCTCGG - Intergenic
922745178 1:228039272-228039294 CTGCCTCTGTGGCCCCATCCTGG - Intronic
922747241 1:228051184-228051206 CTCCCTCCCTGGGCTCTGCCGGG - Intronic
1063005164 10:1963563-1963585 CTCCCTCCGCGCTCTCTGCCGGG + Intergenic
1063411610 10:5840669-5840691 CTGCCTCCAGGGACACTGCCGGG - Intronic
1063597082 10:7445060-7445082 GTGCCTCCGAGGTTCCTGCACGG - Intergenic
1067551654 10:47240607-47240629 CTGCCTCTCTGGTCTCTGGCTGG - Intergenic
1067569417 10:47360566-47360588 CCACCTCCAAGGTCCCTGCCTGG + Intergenic
1069897884 10:71690172-71690194 CTGTCTCCCTGGCCCCTGCTTGG - Intronic
1072899412 10:99394071-99394093 CTGGCCCCGGGGTGCCTGCCTGG + Exonic
1073076879 10:100829774-100829796 CTGGGTCCGGGGTCTCTGCCCGG - Exonic
1073106030 10:101032418-101032440 CTGCCTCCGCTGTCGCCGCCGGG - Exonic
1074864572 10:117537324-117537346 CGGCCTGCGCGGGCCCTGCCTGG - Intergenic
1075160700 10:120022225-120022247 CTGCCTGACTGGTCTCTGCCTGG - Intergenic
1075257209 10:120934736-120934758 CTGCCTGCTTTGTCCCAGCCAGG + Intergenic
1075423989 10:122327565-122327587 CTGCCTCGGGGGTCCCAGCTTGG + Intronic
1076031495 10:127163005-127163027 CTGCATCCTTGGTCCGGGCCCGG + Intronic
1076590312 10:131578091-131578113 CTGCTGCCGTGGTCCCACCCTGG + Intergenic
1076978910 11:195093-195115 CTGCCTACGTGGCGTCTGCCTGG - Intronic
1076979055 11:195704-195726 CTGCCTACATGGTATCTGCCTGG + Intronic
1077110614 11:860532-860554 GGCCCTCCGTGGGCCCTGCCAGG + Intronic
1077299307 11:1839822-1839844 CTGCCTGCGTCCTCCCTCCCTGG + Intronic
1077541746 11:3149781-3149803 CGGGCTACGTGGTGCCTGCCAGG - Intronic
1078390694 11:10933092-10933114 CTGCCTCTGTGGCCTCTGCCTGG - Intergenic
1078449327 11:11428518-11428540 CTGCCTCCCTGTTCCCTCACAGG + Intronic
1078642489 11:13109365-13109387 CAGCCTGCATTGTCCCTGCCTGG - Intergenic
1081099693 11:38986585-38986607 CTGCCTCAGTGGCCACAGCCTGG + Intergenic
1081908126 11:46682064-46682086 CTGGCTCCGTGATGCCTACCGGG - Exonic
1083037304 11:59651336-59651358 CTGCCACCCTAGTCCCTGCCTGG + Intronic
1083726779 11:64632622-64632644 CTGCCTCCCAGCTCCCTGGCCGG - Intronic
1083923987 11:65794992-65795014 CAGCCTCTGAAGTCCCTGCCAGG + Intronic
1085044046 11:73343216-73343238 CCGCCTCCGGGGAGCCTGCCGGG + Intronic
1089398712 11:118152459-118152481 CTTCCTGCCTGGTTCCTGCCTGG - Intronic
1089639120 11:119835529-119835551 CTGACTCTGTGGTATCTGCCAGG - Intergenic
1090356984 11:126146862-126146884 CTGACTCCTGGGTCCCGGCCCGG + Intergenic
1090425625 11:126605244-126605266 GTGCCTCCTTAGTCACTGCCAGG + Intronic
1091893922 12:4084881-4084903 CTGCCCCAGTGGTGCCTCCCGGG + Intergenic
1093630595 12:21404384-21404406 CTCCCTCCCTGCTCCCTGACAGG + Intronic
1096214442 12:49791725-49791747 CTGCCTCCTTGGTCCCTTCAGGG + Exonic
1096235485 12:49923422-49923444 CTGCCTGCGTGCTCCCTGTCAGG - Intergenic
1096475525 12:51907038-51907060 CTTCCTCGGTGGCCCCTTCCCGG + Intronic
1096771437 12:53938494-53938516 CTCCCTCCCTGGGGCCTGCCGGG + Intergenic
1103216963 12:119208994-119209016 CAGCCTCTGTTGTCCTTGCCAGG - Intronic
1104353107 12:128061893-128061915 CTTCCTGCGTTCTCCCTGCCTGG + Intergenic
1104631387 12:130405634-130405656 GTGGCTCTGAGGTCCCTGCCAGG + Intronic
1104949703 12:132433876-132433898 CTGCCCCCGTTGTCCTGGCCTGG + Intergenic
1104978125 12:132561155-132561177 CTGCCTCCGGGGCCTCTGCTAGG + Intronic
1105407094 13:20142109-20142131 CCTCCTCGGGGGTCCCTGCCAGG + Exonic
1107364451 13:39655669-39655691 CTGCCTCCGTGGTCCCTGCCTGG + Exonic
1113340294 13:109416300-109416322 ATGCCTCCGTGGACCCTGGATGG - Intergenic
1113774317 13:112934147-112934169 CTGCCGCCAGGGTCCCTGCCAGG - Intronic
1113866943 13:113532585-113532607 CCAGCACCGTGGTCCCTGCCTGG - Intronic
1113886745 13:113665047-113665069 CGGCCTCTGTAGACCCTGCCAGG + Intergenic
1113890958 13:113735421-113735443 CTGCCTCCGTGGTGCCAGCCTGG + Exonic
1114173268 14:20295780-20295802 CTGCAGCCCTGGACCCTGCCTGG - Exonic
1121098547 14:91234135-91234157 CCGCCTCCGCGGGGCCTGCCTGG - Exonic
1121101767 14:91254316-91254338 CAGCCTCCTGGGTCCCTGCCCGG + Intergenic
1121275848 14:92667030-92667052 TTGACTCTGTGGTCTCTGCCAGG - Intronic
1121511787 14:94517964-94517986 AAGCCTCCGTGGCCCCTGGCTGG + Intergenic
1122027304 14:98887121-98887143 CTGACTCAGAGGGCCCTGCCAGG + Intergenic
1122092985 14:99352282-99352304 CTGCCTCCGTGGCTCCAGTCAGG + Intergenic
1122984305 14:105205258-105205280 CAGCCGCCGTGGTCTCTGCCAGG - Intergenic
1122999057 14:105282281-105282303 TTGCCTCCGTGCACCCTGCGAGG - Intronic
1123009471 14:105340815-105340837 CTGGGTCCGTGGTGGCTGCCTGG + Intronic
1123023880 14:105414695-105414717 CTGCCCCCGGGTTTCCTGCCGGG - Intronic
1123125954 14:105946118-105946140 CTGCCTCCTTGTTCCCTGCCTGG + Intergenic
1123406537 15:20022536-20022558 CTGCCTCCTTGTTCCCTGCTTGG + Intergenic
1123515867 15:21029184-21029206 CTGCCTCCTTGTTCCCTGCTTGG + Intergenic
1127964165 15:63911688-63911710 CTGCATCAGTGGTCCCCTCCCGG + Intronic
1129875379 15:78972061-78972083 ATGCCTCCGTGGGACCTTCCAGG - Intronic
1130533260 15:84764094-84764116 CTGCCCCCCTGGCCCCTGCTTGG + Intronic
1130670668 15:85909751-85909773 CTGCCTAAGTGGTCTCTGCAAGG + Intergenic
1131505728 15:93017143-93017165 CTCCAGCAGTGGTCCCTGCCTGG + Intronic
1132142518 15:99407352-99407374 CTGTCTGCGTGGTCCTGGCCTGG + Intergenic
1132405903 15:101541765-101541787 CTGCCTCCTGGTGCCCTGCCAGG - Intergenic
1132670007 16:1098666-1098688 CTGGCTCCGTGTTCCCAGGCTGG + Intergenic
1132744987 16:1432785-1432807 CTTCCTCCGTGGCCTCTGCCCGG - Intergenic
1132748529 16:1446907-1446929 GTGCTTCCGTGTCCCCTGCCGGG + Intronic
1132829022 16:1918513-1918535 CCGCCTCCGAGGCCACTGCCTGG + Intergenic
1132836134 16:1954356-1954378 CTGCCTCTGTGGGCTCAGCCTGG + Intronic
1132843610 16:1990198-1990220 CTGGGTGAGTGGTCCCTGCCCGG + Exonic
1133110586 16:3545807-3545829 CTGCTTCCTTTGTCCCTCCCTGG - Intronic
1133302437 16:4790852-4790874 CTGCCACCCTGGGCCCTGCCTGG - Intronic
1133320204 16:4909059-4909081 CTGCCTCCCTGGCCTCTGCCTGG - Intronic
1133771012 16:8867279-8867301 CTCCCTCTGTGACCCCTGCCAGG + Intronic
1135184901 16:20307137-20307159 CTGCCACCTTCATCCCTGCCTGG + Intergenic
1135420161 16:22300445-22300467 CAGCCTCCCTGATCCCTGGCAGG + Intronic
1135480095 16:22814772-22814794 CTGCCTCCGCGGCCCCAGCGCGG + Exonic
1138244149 16:55454072-55454094 CTTCCTCCTTGTGCCCTGCCTGG + Intronic
1138493773 16:57394433-57394455 CTGCCTCCCTGATCCCTGGGTGG + Intergenic
1138559509 16:57792272-57792294 CTGCCTTCTTGGCCCCTGCCTGG + Intronic
1139950489 16:70665966-70665988 CTGCCTCTGAGGTCTCTGCATGG + Intronic
1140485318 16:75288817-75288839 CGGCCTTCCTGGTCCCTGCCAGG + Intergenic
1141636651 16:85317509-85317531 CAGCCCCCGTGGTCCGTGGCAGG + Intergenic
1142231189 16:88901028-88901050 CTGCCTCTGTGGTCCCTCCACGG + Intronic
1142284813 16:89167403-89167425 TGGCCTCCCTGATCCCTGCCCGG + Intergenic
1142286097 16:89172129-89172151 CTACCTGGGTGGCCCCTGCCTGG - Intronic
1142466400 17:139911-139933 CTGCCTGCGTGGCGTCTGCCTGG - Intergenic
1142466545 17:140522-140544 CTGCCTACATGGTATCTGCCTGG + Intergenic
1142622894 17:1176186-1176208 CAGCCTCAGCTGTCCCTGCCTGG + Intronic
1144873030 17:18382206-18382228 CAGCCTCAGTGCTTCCTGCCTGG - Intronic
1145237770 17:21221149-21221171 CAGCCTCTGAGGTGCCTGCCAGG - Intergenic
1147375011 17:40018081-40018103 GTGCCTCTGTCTTCCCTGCCAGG - Intergenic
1147425467 17:40344059-40344081 CTGCCTCCCTCCTGCCTGCCAGG + Intronic
1148485372 17:47987483-47987505 CTTCCTCCCTGGTGACTGCCAGG + Intergenic
1149602961 17:57904859-57904881 CTGCCCCTGTGGTCCCAGCACGG - Intronic
1151251909 17:72842755-72842777 CTACTTCCGTGGCGCCTGCCTGG - Intronic
1151748214 17:76022794-76022816 CAGCCTCAGTGCTTCCTGCCTGG + Intronic
1152698545 17:81807904-81807926 CATCCCCCGTGGTGCCTGCCAGG - Intronic
1152750210 17:82059103-82059125 CTGCTCCCCTTGTCCCTGCCTGG - Intronic
1152922351 17:83072466-83072488 CTGCCTCTGTGGGTCCTGTCTGG + Intergenic
1153720463 18:7896456-7896478 CTGCCTCCCTGGCCTCTGACTGG - Intronic
1153961494 18:10143760-10143782 CTGCCTCTGTGTACCCTGCATGG + Intergenic
1154177181 18:12093275-12093297 CTTCCTCCTGAGTCCCTGCCGGG + Intergenic
1155023338 18:21916844-21916866 CTGCCTCTGAGGTCCATGGCGGG - Intergenic
1156456504 18:37297690-37297712 CTGCCTTTGGGGACCCTGCCTGG - Intronic
1157491985 18:48129930-48129952 CTGCCTCCCTGCTCCCTAGCAGG + Intronic
1157606350 18:48928242-48928264 CTGCCTTCATGGTCTCTGGCTGG + Intronic
1157615921 18:48987643-48987665 CTGCCCCAGTGGTTGCTGCCAGG - Intergenic
1160227107 18:77019921-77019943 CTGCCTCCCAGGTTACTGCCTGG - Intronic
1160454865 18:78993027-78993049 CTGGCCCCGGGGTCCCTGCTGGG + Exonic
1160532992 18:79576501-79576523 CTACCTCCGTGGGCCTTGGCCGG + Intergenic
1160700079 19:501889-501911 CTCCCTGCGTGGGCCCAGCCTGG - Exonic
1160910749 19:1472755-1472777 CTCCCACCGCGGCCCCTGCCTGG + Exonic
1160920953 19:1520334-1520356 CCAGCTCCCTGGTCCCTGCCTGG - Intergenic
1160970897 19:1767370-1767392 CTGCCCTCTTGGGCCCTGCCTGG - Intronic
1161030526 19:2056049-2056071 CTGCCTGTGTGGGCCGTGCCTGG + Intergenic
1161420628 19:4174457-4174479 TGCCCTCCGTGGTCCCTCCCTGG - Exonic
1161850684 19:6736711-6736733 CTGCCTCCTTGGTCTCCGGCAGG - Exonic
1162497353 19:11030722-11030744 CCGCCTTCGTGGTTCCTGACGGG - Exonic
1162542981 19:11309323-11309345 CTGTCTCTGAGGCCCCTGCCTGG - Intronic
1162548738 19:11346589-11346611 CTGGCTTCGTGGTCCCTGATGGG + Exonic
1162744261 19:12790093-12790115 CTGCCTCCGCGGTCCCCTGCAGG + Intronic
1162764912 19:12913240-12913262 CTGCCAGCGTGGGCCCTGCTTGG - Intronic
1162794522 19:13079615-13079637 CTGCCTCTGGGCTCCCAGCCAGG - Intronic
1163038118 19:14583349-14583371 CCTCCTCCATGGTCCCTTCCAGG - Exonic
1163038807 19:14587606-14587628 CCTCCTCCATGGTCCCTTCCAGG - Exonic
1163039553 19:14592273-14592295 CCTCCTCCATGGTCCCTTCCAGG - Exonic
1163473527 19:17511848-17511870 CCGCCGCCGTCGCCCCTGCCGGG + Exonic
1163480911 19:17555789-17555811 CTGCCGCCGGGGGCCCCGCCGGG + Exonic
1164911394 19:32015128-32015150 CTGCCCCCGTGGTCCTGGCTGGG + Intergenic
1165357224 19:35311728-35311750 CCACCTCTGTGGCCCCTGCCCGG - Intronic
1165907301 19:39201954-39201976 CTCCCTCCATGGTTCCTGCAGGG - Intergenic
1166213860 19:41323510-41323532 CTGCCCCCATCCTCCCTGCCTGG - Exonic
1166264632 19:41671483-41671505 CTGCCTGCGAGGACCCTGACTGG - Intronic
1166391067 19:42409196-42409218 CTGCCCCCGTGGTGGCTGGCTGG - Intronic
1166766515 19:45254448-45254470 CTGCCTCCCTGGTCTCTCCTGGG + Intronic
1167658798 19:50783547-50783569 CTTCCTCCCTCCTCCCTGCCTGG - Intergenic
1168130858 19:54317660-54317682 CTGTCTCCGTCATCCCTTCCTGG - Intergenic
1168452493 19:56477294-56477316 CTGTCTCGGTGGTCGCCGCCGGG - Exonic
925008876 2:467408-467430 CTGGCTCTGTGGCCCCTGCATGG + Intergenic
925721472 2:6832645-6832667 CTTCCTCAGTGGTACATGCCTGG - Intergenic
926212129 2:10878896-10878918 CAGACTCTGTGGTCCCTGCCTGG + Intergenic
930036761 2:47090617-47090639 CTGCCTCCCTTCTCCCTGCCAGG + Intronic
930153150 2:48078498-48078520 CTGCCTGTGGGGTGCCTGCCAGG - Intergenic
930712031 2:54558532-54558554 CTTCTTCCGTGGCCCTTGCCTGG - Intronic
930750136 2:54926560-54926582 TTTCCTCCGTAGGCCCTGCCGGG + Intronic
930897630 2:56464172-56464194 CTCCTCCCATGGTCCCTGCCTGG + Intergenic
932702900 2:74003058-74003080 CTGCCTTCCTGGTACCCGCCTGG + Intronic
932763947 2:74458507-74458529 CCACCGCCATGGTCCCTGCCCGG - Exonic
933741594 2:85538605-85538627 CTTCCTTCGGCGTCCCTGCCCGG - Intergenic
934158082 2:89221800-89221822 GGGCCTCCGGGGTCCCTGACAGG - Intergenic
934209182 2:89960624-89960646 GGGCCTCCGGGGTCCCTGACAGG + Intergenic
935273297 2:101453493-101453515 CTGCCTCCTGGGTTCATGCCCGG - Intronic
935759888 2:106310879-106310901 CTTCCTCCCTGCTCCCTGCTTGG + Intergenic
937505438 2:122531467-122531489 TTGTCTCCGTGTTCCTTGCCAGG - Intergenic
938337133 2:130510321-130510343 CTGCCCCGGTGCCCCCTGCCCGG + Intergenic
938352704 2:130610410-130610432 CTGCCCCGGTGCCCCCTGCCCGG - Intergenic
938455600 2:131460789-131460811 CCGCCTCCGCGGTCGCCGCCAGG - Intergenic
938493404 2:131777661-131777683 CTCCAACCCTGGTCCCTGCCAGG + Intergenic
943715967 2:191152133-191152155 CTGCCTCCCTCTTCCCTGACGGG + Intergenic
946456690 2:219832240-219832262 CTGGCTCTTTGGTCCCTGCCTGG - Intergenic
947664439 2:231894783-231894805 CTGCCTCTGTTGCCCCTGCAAGG - Intergenic
947792097 2:232874349-232874371 CTGCCTCAGTGCTCACTTCCTGG - Intronic
947795596 2:232892054-232892076 CTGCCGCTGTGGCCCCCGCCAGG - Intronic
947890747 2:233617074-233617096 CTGCCTCCATGGACCATACCAGG - Intergenic
947892362 2:233635906-233635928 CTGCCTCCATGGACCATACCAGG - Intronic
948732847 2:239978068-239978090 CTGCCTCTGGGATCCCTGCTTGG + Intronic
948945087 2:241215321-241215343 CTGCCTCAGATGCCCCTGCCAGG + Intronic
949050401 2:241894790-241894812 CTGCCTCCCTGCACCCTGCCCGG + Intronic
1168968191 20:1912907-1912929 CTGCCTCTGATGTCCCCGCCTGG + Intronic
1169216434 20:3797017-3797039 CTGCCTCCGTAATCTCTGCCCGG + Intronic
1171419462 20:25008163-25008185 CGGCCTGGGTGGACCCTGCCTGG - Intronic
1172895153 20:38295144-38295166 CTGCCCCCGTGGCCCAGGCCTGG + Intronic
1173904405 20:46615431-46615453 GGGTCTCCGTGGTCCCTCCCTGG - Intronic
1174447188 20:50598020-50598042 CTGCCTCCCTGGTCCCCGCTGGG - Intronic
1175157109 20:56978601-56978623 ATGGCGACGTGGTCCCTGCCTGG - Intergenic
1175447425 20:59032575-59032597 TTGCCCCCGTCGTCCCCGCCGGG - Intergenic
1175831357 20:61966796-61966818 CTGCCACCGTGGCCACTGCGGGG - Intronic
1175884719 20:62283149-62283171 CTGGCCTCGGGGTCCCTGCCCGG - Intronic
1176126633 20:63478467-63478489 CTGCCCCCGTCCTCCCTTCCTGG + Intergenic
1178350001 21:31866116-31866138 CTGCCTCCGTGGCCCTGGGCAGG - Intergenic
1178486477 21:33022962-33022984 CTGCTTCCCGGGTCCCTCCCGGG - Intergenic
1178721499 21:35014698-35014720 CTTCCTCCATGGGCACTGCCAGG + Intronic
1179172724 21:38985266-38985288 CTGCCCCCACGGTCCCTGGCTGG + Intergenic
1179876881 21:44273128-44273150 CTGCCCACCTGCTCCCTGCCAGG - Intergenic
1180185592 21:46137629-46137651 CTGCCTCCGGGGGCCCTCCAGGG - Intronic
1180214216 21:46314548-46314570 CTGCCTGCCTGGGCACTGCCTGG - Intronic
1180994948 22:19960965-19960987 CTGCCCCTGGGGTCCCTGGCTGG + Intronic
1181402978 22:22662583-22662605 GTGCATCTGTGGTCCCTGCATGG - Intergenic
1181415655 22:22756876-22756898 GTGCATCTGTGGTCCCTGCATGG - Intronic
1181417953 22:22773633-22773655 GTGCATCTGTGGTCCCTGCGTGG - Intronic
1181419907 22:22790493-22790515 GTGCATCTGTGGTCCCTGCATGG - Intronic
1181423955 22:22820789-22820811 GTGCATCTGTGGTCCCTGCATGG - Intronic
1181734967 22:24874445-24874467 CCGTCTCTGTGGGCCCTGCCTGG + Exonic
1181788982 22:25248374-25248396 CCGGTCCCGTGGTCCCTGCCTGG - Intergenic
1182214825 22:28707131-28707153 CTACCTCCAGGGTCACTGCCTGG + Intronic
1182903773 22:33920213-33920235 CTTCCTCCGGGGCCGCTGCCTGG + Exonic
1183290816 22:37000722-37000744 CAGCCACCGTTGTCCCTGGCTGG - Intronic
1183362054 22:37387872-37387894 CTGCCTCCGGGGCCCTTCCCTGG + Intronic
1183676092 22:39299614-39299636 CTTCCTCCGGGCTCCCTGCCTGG + Intergenic
1184368931 22:44070305-44070327 CCGCCTCCCTGGGCCCTGCTAGG + Intronic
1184381275 22:44146552-44146574 CTGCCTCCTGGGGCCCAGCCTGG + Intronic
1185173227 22:49305368-49305390 CTGCCGCCGGGGTCCCACCCTGG + Intergenic
950219479 3:11183583-11183605 CTCTCCCCGTGGGCCCTGCCGGG + Intronic
950444329 3:13027481-13027503 GTTCCTCCCTGGCCCCTGCCTGG - Intronic
953658105 3:44870243-44870265 CTGCTTCCGTGTTCCCTTGCTGG + Intronic
955214156 3:56971285-56971307 CTTGCTTCGGGGTCCCTGCCGGG - Intronic
960576034 3:119230580-119230602 CTGCCTCAGTTGCCCCTTCCTGG + Intronic
960942336 3:122943133-122943155 GTCCCTGCCTGGTCCCTGCCCGG - Intronic
961452772 3:127009808-127009830 CTGCCTCCATGGCCCCAGTCTGG - Intronic
961623661 3:128244166-128244188 CTCCCTCCTTGTTCCCTGCTGGG + Intronic
961821295 3:129577033-129577055 CTGCTTCTGGGGTCCCAGCCCGG + Intronic
965749478 3:171961101-171961123 CTGCCTGCCTGTTCCCCGCCGGG + Intergenic
966871233 3:184291601-184291623 CTGCCTTTGTGGGCCCTGGCTGG - Intronic
967896018 3:194396883-194396905 CTGCCGCTCTGGGCCCTGCCGGG - Exonic
967937204 3:194738660-194738682 CTGCCTCCCAGGGCCCTGCCAGG - Intergenic
967989015 3:195117716-195117738 TTCCCTCTGTGGTGCCTGCCCGG + Intronic
968092464 3:195907779-195907801 CTGCCTCTGTGGCCCCACCCTGG - Intronic
968442371 4:630352-630374 CAGCCACCCTGGTCCCAGCCTGG - Intronic
968582824 4:1402896-1402918 CCGCCTCCGAGGCCGCTGCCGGG - Intergenic
968589041 4:1448670-1448692 GTGCCTGTGTGGGCCCTGCCTGG + Intergenic
968786591 4:2626497-2626519 CTGCCAGCGGGGTTCCTGCCTGG - Exonic
968983875 4:3865137-3865159 CTGCCTCCCACCTCCCTGCCTGG + Intergenic
969170916 4:5362640-5362662 CTGCCTCCGTGGTGGCTGTCAGG - Intronic
969797540 4:9537644-9537666 CTGGGTCAGGGGTCCCTGCCAGG + Intergenic
970923863 4:21427481-21427503 CTTCCTCCGTGGTCCCTCAGAGG + Intronic
971372399 4:26029243-26029265 CTGCCGCAGTGAGCCCTGCCAGG + Intergenic
972181910 4:36477083-36477105 CTGCCTCAATGGTCCCTGAAAGG - Intergenic
974100343 4:57409556-57409578 CTGCCACTGTGGTACCAGCCAGG + Intergenic
975613176 4:76221251-76221273 CTGCCTCACTGGTCCTGGCCTGG + Intronic
977373441 4:96170247-96170269 CTGCCTCCTTGCTACCTCCCTGG + Intergenic
979439386 4:120733511-120733533 CTTCCTCAGTGGACCCTACCTGG + Intronic
982582619 4:157198331-157198353 CTGCCTCCCAGGTTCCAGCCCGG + Intergenic
984208615 4:176817795-176817817 GTGCCTCTGTGGACCCTTCCAGG + Intergenic
986356778 5:6936495-6936517 CTTCCTCGGTGTTCCCTGCTTGG - Intergenic
989182292 5:38590439-38590461 CTGCCTCTGTTGTCTGTGCCTGG + Intronic
989568584 5:42924872-42924894 CTACCTCCCTGCTCCCTGGCCGG - Intergenic
990204375 5:53413477-53413499 CAGCCTCCGTGCTGCCAGCCAGG - Intergenic
992149885 5:73892427-73892449 CTGCCTGTGTGCACCCTGCCGGG + Intronic
992747643 5:79835220-79835242 TCGCCTCCGAGGTGCCTGCCTGG - Intergenic
992828231 5:80570021-80570043 CGGCCTCAGTGCTCCCTGCCCGG - Intronic
995574412 5:113514091-113514113 CTGCCAGCATGGTCCCTGTCCGG - Intronic
996413817 5:123187677-123187699 CTGCTTCCGTGGTCCCCGCTGGG - Exonic
997302406 5:132814947-132814969 CTGGCTCCGTGGTGCCTCGCAGG - Exonic
997528207 5:134566926-134566948 TTGCCTCTGTGGGCCCCGCCTGG + Intronic
998769757 5:145529001-145529023 CTCCCTCCGTTTTCCCTGCTAGG + Intronic
999458916 5:151740875-151740897 CTGCCTTCGTGGCCCCTCCGGGG - Intergenic
1001885684 5:175288192-175288214 CTGCCTCTGTGGCTCCTCCCTGG - Intergenic
1002065261 5:176648432-176648454 CTGTCCCCCTGGGCCCTGCCAGG + Intronic
1002209849 5:177592142-177592164 CCGCCGCCGCGGTGCCTGCCGGG - Exonic
1002211313 5:177600834-177600856 CTGCCTGGCTGGTCACTGCCTGG + Intronic
1002334623 5:178469362-178469384 ATCCCTCCCTGGTCCCAGCCTGG + Intronic
1005013488 6:21357352-21357374 CTGCCTCCCTGGATCCTGACGGG + Intergenic
1006398433 6:33801965-33801987 ATGCCTACCTGCTCCCTGCCAGG - Intronic
1006436217 6:34027384-34027406 CAGCTGCCGAGGTCCCTGCCTGG + Intronic
1007132216 6:39486016-39486038 CAGCCTCCAGAGTCCCTGCCAGG + Intronic
1007607876 6:43129540-43129562 GTGCCTGCCTGGTCCCTGGCAGG - Intronic
1008457555 6:51728254-51728276 CTGCCATCGTAGACCCTGCCAGG - Intronic
1009234266 6:61103597-61103619 CTGCCTCAATGGTCCCTGATGGG - Intergenic
1014872776 6:126616214-126616236 CTGCTTCTGTATTCCCTGCCAGG - Intergenic
1016937700 6:149459799-149459821 CTGCCTGCCTGCTCCATGCCAGG + Intronic
1018317556 6:162571729-162571751 CTGCCTCCTAGCTCCATGCCAGG - Intronic
1019316385 7:388860-388882 CTCCCTCCTGGCTCCCTGCCCGG - Intergenic
1019444768 7:1065665-1065687 CCGCCTCCGTCGCCCCTCCCTGG - Intronic
1019666161 7:2253173-2253195 CTGACCCCGGAGTCCCTGCCAGG + Exonic
1019907396 7:4075098-4075120 CTGCCTTTGGGGTCTCTGCCTGG - Intronic
1019912202 7:4107299-4107321 CTGCCTTCCGGGTCCTTGCCTGG - Intronic
1022537960 7:31109691-31109713 CTGCCTCCCTGCTCCCTGGCTGG - Exonic
1024781594 7:52857106-52857128 ATACCTCCGAGCTCCCTGCCAGG + Intergenic
1025242049 7:57285020-57285042 CTGCCTCCCGACTCCCTGCCAGG - Intergenic
1026673905 7:72413076-72413098 CTGCCTCTGTGATCTCTGCCAGG - Intronic
1027436021 7:78165210-78165232 CTGCCTCAGTGATCCATGCCTGG - Intronic
1029121410 7:98270645-98270667 CTGCCTCCCTGGTCTGTTCCGGG - Intronic
1030016404 7:105226853-105226875 CTGCCTCCGAGGTTCAAGCCTGG - Intronic
1030884742 7:114922963-114922985 CTTCCTCCGTGCGCCCTGCCGGG + Exonic
1034259342 7:149745080-149745102 ATTCCTCTGTGCTCCCTGCCAGG - Intergenic
1034282126 7:149861812-149861834 CTTCCTCTTTGGGCCCTGCCTGG - Exonic
1034406177 7:150903748-150903770 CTGCCACCCTGGGCCCTGGCTGG - Intergenic
1034527642 7:151675753-151675775 CTGCCCCCGACGTCCCTTCCTGG - Intronic
1035631183 8:1107568-1107590 CTGCCTCCGTGTTTCCACCCTGG - Intergenic
1035990493 8:4484642-4484664 CTTCCTGCATGGTCCCTACCTGG + Intronic
1036130103 8:6102149-6102171 CTGCCTCCGTGATCGCACCCAGG + Intergenic
1036213935 8:6863650-6863672 CAGCCTCCCTTGTCCCCGCCAGG - Intergenic
1037994372 8:23341863-23341885 CTACCTCCCTGATCCCTGCCAGG - Intronic
1038761973 8:30392652-30392674 CTGCCTCAGTTGCCACTGCCAGG - Intronic
1039408135 8:37330025-37330047 GTGCCTCCTTTCTCCCTGCCAGG - Intergenic
1039893737 8:41701765-41701787 CCGTCCCCGTGGTTCCTGCCCGG - Intronic
1040556118 8:48478767-48478789 GTGCCTCTGTGCTTCCTGCCTGG - Intergenic
1045288355 8:100811249-100811271 CTGCCTCAGTGGGAGCTGCCTGG - Intergenic
1047367716 8:124227729-124227751 CAGCACCCGTGGTCCCTGCATGG + Intergenic
1049466204 8:142752290-142752312 CTGCCTCTGAGGCCCCTTCCTGG + Intronic
1049477276 8:142802583-142802605 CTGCCTCTGGCTTCCCTGCCTGG - Intergenic
1049742972 8:144249833-144249855 CTGCCTCCGGTGGGCCTGCCAGG + Intronic
1049761608 8:144334277-144334299 CTGTCTCCATCCTCCCTGCCCGG - Intronic
1051497029 9:17735036-17735058 CTGCCTCCGGGCTCCCTTCCTGG + Intronic
1052665267 9:31487406-31487428 CAGCCTCCCTGTTCCCTTCCTGG - Intergenic
1052851537 9:33381330-33381352 CTGCCTCCAGGGCCCCTCCCAGG + Intergenic
1053494632 9:38541347-38541369 CTCCCTCCATGGACCCTGCGTGG - Exonic
1054973950 9:71121043-71121065 CTGGCTCTGTGGTCCGTGGCTGG - Intronic
1056338317 9:85600237-85600259 CTGCCTTCCTGATCCCTTCCTGG + Intronic
1056551934 9:87659642-87659664 CTGTATCAGTGGTCCCCGCCTGG + Intronic
1057171661 9:92966576-92966598 CTGCACCTGTGGGCCCTGCCCGG + Intronic
1059391275 9:114001103-114001125 CTGCCCCTGGGGTCCCTGCCAGG + Intronic
1060141772 9:121216583-121216605 CTTCCTCTGTGATGCCTGCCAGG + Intronic
1060191751 9:121598418-121598440 CCGCCTCCGTGGTCGGTCCCGGG - Intronic
1060555063 9:124503822-124503844 CTGCCTCCTTCGTCTCTGTCGGG - Intronic
1060660756 9:125403991-125404013 CTGCTTCCATGACCCCTGCCTGG + Intergenic
1060984309 9:127810762-127810784 CTGCCTCAGTATACCCTGCCTGG - Intronic
1061589696 9:131590428-131590450 CTGCCTCCCTGGGCTCTGCAAGG + Intronic
1061789046 9:133048964-133048986 CTGCCTCCTTGGCCCCTTCCTGG + Intronic
1061818351 9:133209003-133209025 CTGACCCCGTGCTCCCAGCCTGG - Intronic
1062242100 9:135546355-135546377 CTGACCCCGTGCTCCCAGCCTGG + Intronic
1062248621 9:135583256-135583278 CTGGGCCCGTGGTCCCTCCCTGG + Intergenic
1062379937 9:136282242-136282264 CTGCCTCCATGGTCACAGCCCGG - Intronic
1062496949 9:136836406-136836428 CTGATTCCGTGGTCCCTGCCTGG - Intronic
1062589376 9:137266600-137266622 GTGTCTCCGTGGACCCTGGCTGG + Intronic
1202779765 9_KI270717v1_random:24095-24117 CCGCCGCCGTGGCCCCCGCCCGG - Intergenic
1192125767 X:68499305-68499327 CTGCCCTCGTGGTTCCTTCCAGG + Intronic
1194206818 X:91019879-91019901 CTGCCTCCATGTTCCCTGCCTGG + Intergenic
1200063767 X:153495283-153495305 CGGCCCCCTTGGTCCCTGTCAGG + Intronic
1200075561 X:153548980-153549002 CTGCCCCCTGGGTCCCTGCTCGG - Intronic
1200129425 X:153832823-153832845 CAGCCTCTATGGTCCCTGCTGGG + Intergenic
1200552569 Y:4594668-4594690 CTGCCTCCATGTTCCCTGCCTGG + Intergenic