ID: 1107364751

View in Genome Browser
Species Human (GRCh38)
Location 13:39658214-39658236
Sequence GCAAGATCAAGGCTACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107364751_1107364761 28 Left 1107364751 13:39658214-39658236 CCTTACTGTAGCCTTGATCTTGC 0: 1
1: 0
2: 1
3: 11
4: 223
Right 1107364761 13:39658265-39658287 TCCCAGGTAGCTGGGTCTACAGG 0: 7
1: 1772
2: 49080
3: 164209
4: 224637
1107364751_1107364754 12 Left 1107364751 13:39658214-39658236 CCTTACTGTAGCCTTGATCTTGC 0: 1
1: 0
2: 1
3: 11
4: 223
Right 1107364754 13:39658249-39658271 TCCTCCTGCCACAGCCTCCCAGG 0: 1
1: 346
2: 4976
3: 7459
4: 7359
1107364751_1107364759 20 Left 1107364751 13:39658214-39658236 CCTTACTGTAGCCTTGATCTTGC 0: 1
1: 0
2: 1
3: 11
4: 223
Right 1107364759 13:39658257-39658279 CCACAGCCTCCCAGGTAGCTGGG 0: 20
1: 4092
2: 103220
3: 211903
4: 250349
1107364751_1107364757 19 Left 1107364751 13:39658214-39658236 CCTTACTGTAGCCTTGATCTTGC 0: 1
1: 0
2: 1
3: 11
4: 223
Right 1107364757 13:39658256-39658278 GCCACAGCCTCCCAGGTAGCTGG 0: 11
1: 3179
2: 90203
3: 199171
4: 238483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107364751 Original CRISPR GCAAGATCAAGGCTACAGTA AGG (reversed) Intronic
900613069 1:3552623-3552645 GGGAGTTCAAGGCTGCAGTACGG + Intronic
904369748 1:30040814-30040836 ACATGAGCAAGGCTACAGGAGGG + Intergenic
906519359 1:46458148-46458170 GCAAGAGCCTGGCTGCAGTACGG - Intergenic
906695194 1:47818718-47818740 GCAAGTTAAAGGCCACAGCAAGG - Intronic
906748334 1:48237204-48237226 CCAAGATCAATGCCACAGTAAGG + Intronic
906980432 1:50622987-50623009 GCAAAAACTAGGGTACAGTATGG - Intronic
908636922 1:66177190-66177212 GAAAGATAAAACCTACAGTATGG + Intronic
912568233 1:110604380-110604402 GGAAGATGAAGGCTACATCAAGG - Exonic
913640089 1:120804358-120804380 GCAAGATCAAGGTTATGGTCAGG - Intergenic
914212424 1:145592271-145592293 GCAAGATCAAGGTTATGGTCAGG + Intergenic
914278387 1:146145980-146146002 GCAAGATCAAGGTTATGGTCAGG + Intronic
914539434 1:148596928-148596950 GCAAGATCAAGGTTATGGTCAGG + Intronic
914627247 1:149474700-149474722 GCAAGATCAAGGTTATGGTCAGG - Intergenic
916088674 1:161290076-161290098 GCAAGATCAAGGGGACATCAAGG - Intergenic
916117192 1:161496071-161496093 CCAAGATCAAGGTGTCAGTAGGG - Intergenic
917505636 1:175624634-175624656 GCAAAATCAAGGCATCAGCAGGG - Intronic
918986249 1:191630981-191631003 CAAAGATCAAGGATACAGAAAGG + Intergenic
919265642 1:195261225-195261247 CCAAGATCAAGGTGTCAGTAGGG + Intergenic
920562498 1:206948627-206948649 GCAGAGTCCAGGCTACAGTAGGG - Intergenic
923042754 1:230331542-230331564 GCAAGCTGAAGGCTAGAGTTTGG - Intronic
923806984 1:237268357-237268379 GCAAGATCAAAGCTATATTGTGG - Intronic
923850125 1:237785194-237785216 GAAAGATGTAGGCTACAGTTAGG - Intronic
1064008278 10:11715040-11715062 TCAAGATCAAAGACACAGTAGGG + Intergenic
1064470056 10:15626837-15626859 CCAAGATCAAGGCGTCAGCAGGG - Intronic
1069467281 10:68652759-68652781 GGGAGATCAAGGCTGCAGTGAGG - Intronic
1069618475 10:69821374-69821396 CCAAGGTCAAGGCTGAAGTAAGG - Intronic
1069990089 10:72309797-72309819 GCAAGAGAGAGGCTACAGCAGGG - Intergenic
1070416985 10:76200032-76200054 GGGAGGTCAAGGCTGCAGTAAGG - Intronic
1070516872 10:77215999-77216021 CTAAGATCAAGGCAACAGCATGG - Intronic
1071025414 10:81107237-81107259 CCAAGATCAAGGTTTCAGCAGGG - Intergenic
1072176372 10:92926604-92926626 GGGAGTTCAAGGCTACAGTGAGG - Intronic
1073312633 10:102554710-102554732 GCCAGATCAAGGCAGCAGCATGG + Intronic
1073329263 10:102660292-102660314 GCAAGACCAAGGCTATGGTTTGG - Intergenic
1074469766 10:113716082-113716104 GCAAGGTCAAGGGGACAGGATGG + Intronic
1075173234 10:120135020-120135042 GCAAGTTCAAGGCTCCAAGATGG - Intergenic
1075682772 10:124344223-124344245 CCAAGATCAAGGGGCCAGTAGGG + Intergenic
1079674251 11:23204026-23204048 ACAAGTTCAAGGCTGCAGTGCGG + Intergenic
1079702140 11:23561518-23561540 CCAAGATCAAGGTGCCAGTAAGG - Intergenic
1084289229 11:68151217-68151239 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
1084515036 11:69633104-69633126 AGGAGGTCAAGGCTACAGTAAGG + Intergenic
1086975333 11:93125827-93125849 CCAAGATCAAGGCAACAGTATGG + Intergenic
1087137263 11:94733437-94733459 GCAAAAACAGGGCTACAGCAAGG + Intronic
1087541373 11:99525203-99525225 GCAAGATCAAAACTAAAGTCAGG + Intronic
1087678459 11:101190010-101190032 CCAAGATCAAGGCACCAGCAGGG - Intergenic
1088124967 11:106413381-106413403 GCAAGATCAAGTTTCCAGTGGGG + Intergenic
1089096517 11:115924294-115924316 GGAAGGTCAAGGCTGCAGTTAGG - Intergenic
1094850474 12:34380170-34380192 GCCAGCTCAAGGCTGCAGGAAGG - Intergenic
1098719747 12:73881664-73881686 CCAAGATCAAGGTGCCAGTATGG - Intergenic
1099486350 12:83233205-83233227 GCAAGATCAATGCAAAAGGAAGG - Intergenic
1105561468 13:21496391-21496413 CCAAGATCAAGGCACCAGCAGGG - Intronic
1107364751 13:39658214-39658236 GCAAGATCAAGGCTACAGTAAGG - Intronic
1108199677 13:48030796-48030818 AGAAGATCAAGGTGACAGTAGGG + Intergenic
1110670848 13:78175828-78175850 GCAAGACCAAGGCGCCAGTGAGG + Intergenic
1111906353 13:94260410-94260432 CCAAGATCAAGGTGTCAGTAGGG + Intronic
1116777808 14:49201837-49201859 CCAAGATCAAGGTGTCAGTAGGG - Intergenic
1117221816 14:53613698-53613720 GCAAGATGAAGGTTACTGCATGG + Intergenic
1117227214 14:53674498-53674520 CCAAGATCAAGGTTCCAGCAAGG - Intergenic
1117748616 14:58897570-58897592 TCAAGATCAAGGTATCAGTAGGG - Intergenic
1118462545 14:66000119-66000141 TCAAGATCAAGGCCTCAGTATGG - Intronic
1118570686 14:67191656-67191678 GGATGATCAAGGCTCCATTAGGG - Intronic
1118877413 14:69796988-69797010 GCAAGATCAAGGCTCACTTATGG - Exonic
1122024679 14:98867210-98867232 CCAAGATCAAGGTGTCAGTAGGG - Intergenic
1122471876 14:101973729-101973751 AGAAGATCAAGACTACAGTGAGG + Intronic
1124699764 15:31902821-31902843 CCAAGATCAAGGGTTCAGTAGGG - Intergenic
1124815769 15:32990544-32990566 GGAAGGTCAAAGCAACAGTATGG + Intronic
1128317862 15:66672382-66672404 CCAAGATCAAGGCACCAGCAGGG + Intronic
1129947358 15:79550794-79550816 CCAAGATCAAGGTGACAGCAGGG + Intergenic
1130189735 15:81722309-81722331 TCAAGATCAAGGATTCAGCAGGG - Intergenic
1131547386 15:93327289-93327311 GAAAGATGAGGGCTACAGTCGGG - Intergenic
1132006103 15:98228722-98228744 CCTAGATCATGGCTGCAGTATGG - Intergenic
1134913910 16:18053181-18053203 CCAAGATTAAGGTGACAGTAGGG + Intergenic
1136139990 16:28282267-28282289 GCAAGATCTCGGCTGCAGAAAGG + Intergenic
1137465796 16:48707754-48707776 CCAAGATCAAGGTGCCAGTAAGG - Intergenic
1137466367 16:48713511-48713533 CCAAGATCAAGGTTACAGCAAGG - Intergenic
1138593744 16:58018194-58018216 CCAAGATCAAGGTGACAGCATGG + Intronic
1139025506 16:62812738-62812760 GCAAGATCAAGGTGTCAGCAGGG - Intergenic
1139078869 16:63489905-63489927 CCAAGATCAAGGTGCCAGTAGGG + Intergenic
1141368519 16:83466102-83466124 GGAAGAACAAGGCTACTGCAGGG - Intronic
1142381386 16:89734182-89734204 GGTAGATGAAGGCTAGAGTAGGG + Intronic
1143286248 17:5791329-5791351 GCCAGATCAAAGCTACCTTATGG + Intronic
1144261061 17:13521311-13521333 CCAAGATCAAGACTACATTTTGG - Intronic
1145720947 17:27072187-27072209 GCAAGATGAAGGCTAAGGTCAGG + Intergenic
1148222852 17:45876349-45876371 AGAAGATCGAGGCTACAGTGAGG + Intergenic
1148724068 17:49776055-49776077 GTAACATCAAGGCTCCAGGAAGG + Intronic
1149762863 17:59248224-59248246 AGACGATCAAGGCTACAGTGAGG + Intronic
1149987109 17:61355554-61355576 ACAAGGTCAAGGGTACAGTCAGG - Intronic
1150053330 17:61987822-61987844 GAGAGGTCAAGGCTACAGTGAGG - Intronic
1152047495 17:77947144-77947166 GCAAGAGCAAAGCTGTAGTAGGG - Intergenic
1152388513 17:79989389-79989411 GCCCGATCAAGGCCACAGTGTGG - Intronic
1153642114 18:7166130-7166152 CCAAGGTCAAGGCATCAGTAGGG - Intergenic
1153982829 18:10326465-10326487 TCAAGATCAAGGTTCCAGCAGGG + Intergenic
1154000513 18:10478471-10478493 CCAAGATCAAGGCACCAGCATGG + Intronic
1154260832 18:12831084-12831106 GAAAGAGCAAGGCTCCAGGAAGG + Intronic
1154367053 18:13720791-13720813 CCAAGATCAAGGTGTCAGTAGGG + Intronic
1157784130 18:50466972-50466994 CCAAGATCAAGGTGACAGCATGG + Intergenic
1161863817 19:6819388-6819410 CCAAGATCAAGGTGTCAGTAGGG - Intronic
1162455831 19:10784283-10784305 GCACGATCAAGAATCCAGTAGGG + Intronic
1163288827 19:16365468-16365490 CCAAGATCAAGGCGCCAGTGGGG - Intronic
926805771 2:16709493-16709515 CCAAGATCAAGGTTACGGCAGGG + Intergenic
927412183 2:22839242-22839264 GCAAGAACAATGGTACAGGAAGG - Intergenic
928117348 2:28555939-28555961 GGGAGATCAAGGCTGCAGTGAGG - Intronic
928365805 2:30700981-30701003 CCAAGATGAAGGTGACAGTAGGG + Intergenic
931047627 2:58374029-58374051 CCAAGATCAAGGTTCCAGCAAGG + Intergenic
931226015 2:60332915-60332937 CCAAGATCAAGGTGCCAGTAGGG - Intergenic
932891994 2:75605523-75605545 CCAAGATCAAGGTAGCAGTAGGG - Intergenic
934066215 2:88344533-88344555 GCAAGTTCATGGCTAAAGGAAGG - Intergenic
934884950 2:98016342-98016364 GCCAGATGAATGCTACAGGAGGG + Intergenic
935479239 2:103563649-103563671 GGAAGGTCAAGGCTACAGGGAGG + Intergenic
940521243 2:154751751-154751773 CCAAGATCAAGGAGTCAGTAGGG + Intronic
941184753 2:162308186-162308208 CCAAGATCAAGGTGACAGCAGGG + Intronic
941187189 2:162331654-162331676 CCAAGATCAAGGGTACAGATAGG - Intronic
941539110 2:166760499-166760521 GGGAGATCAAGGCTGCAGTGAGG - Intergenic
942413026 2:175731454-175731476 CCAAGATCAAGGTGACAGTAGGG - Intergenic
942772497 2:179539152-179539174 CCAAGATCAAGGTGCCAGTATGG + Intronic
943331315 2:186562696-186562718 GAAAGATCAAGGATAAAGAAAGG + Intergenic
943954303 2:194167025-194167047 CCAAGATCAAGGTGCCAGTATGG - Intergenic
944736693 2:202573284-202573306 GGAAGACCAAGGTTACAGTGGGG - Intergenic
944754783 2:202750044-202750066 GCAAGATCAAGGTGCCAGCAGGG + Intronic
947441983 2:230131465-230131487 CCAAGATCAAGGCTCCGGCAGGG + Intergenic
947521865 2:230851840-230851862 GCAAGATCAAAGCACCAGTAGGG - Intergenic
948781965 2:240327353-240327375 TCAAAATCAAGGCATCAGTAGGG + Intergenic
1169605143 20:7309322-7309344 CCAAGATCAAGGTTCCAGCAAGG + Intergenic
1169931239 20:10835425-10835447 CCAAGAACAAAGCTACAGGAGGG - Intergenic
1169967429 20:11233244-11233266 GAAAGATCAAGGCAATATTAAGG - Intergenic
1170762054 20:19259614-19259636 GAAAGATCAATGCAACAGCAAGG - Intronic
1174814075 20:53671568-53671590 CCAAGATCAGGGCACCAGTATGG - Intergenic
1177675205 21:24288827-24288849 CCAAGATCAAGGTGCCAGTATGG + Intergenic
1178677271 21:34641907-34641929 GAAAGATCAAGGGAACAGCATGG + Intergenic
1178807612 21:35852338-35852360 CCAAGATCAAGGTGCCAGTAGGG - Intronic
1179378483 21:40875677-40875699 TCAAGATCAAGAACACAGTAAGG + Intergenic
1180247334 21:46557029-46557051 GCAAAACCAAGGCCACAGTAGGG - Exonic
1181010597 22:20038235-20038257 CCAAGATCAAGGCGTCAGCAGGG - Intronic
1181615702 22:24052876-24052898 GCAAGAGCAAGGCACGAGTAAGG + Intronic
1182159787 22:28110117-28110139 GCATGATCAAGGCTGAAGTCAGG + Intronic
949571689 3:5299969-5299991 CCAAGATCAAGGCATCAGCAGGG - Intergenic
949964134 3:9340970-9340992 CCAAGATCAAGGAGCCAGTATGG + Intronic
951111664 3:18811237-18811259 GCAAGATCAAGGGGTCAGCAGGG - Intergenic
951932651 3:27985984-27986006 ACAAGATCAAGGCATCAGCAAGG - Intergenic
954197017 3:49002913-49002935 GCAGGAGCAAGGCGACAGTGAGG + Intronic
955929055 3:64037424-64037446 GCAAGATCAAGGTATCAGCAGGG + Intergenic
956858479 3:73299207-73299229 GCACGATCCAGGCAACAGGAAGG + Intergenic
958167287 3:89893183-89893205 GGAAGGTGGAGGCTACAGTAAGG - Intergenic
959809578 3:110600080-110600102 AAAAGATGAAGGCTACAGAATGG - Intergenic
960517158 3:118615048-118615070 TCAAGATCAAGGTGTCAGTAGGG - Intergenic
960633349 3:119755602-119755624 CCAAGATCAAGGTGACAGCATGG - Intronic
961499344 3:127320762-127320784 GTGAGATCAAGGCTAGAGGAAGG - Intergenic
961868726 3:129973397-129973419 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
963993320 3:151678777-151678799 GGAGGATCAAGGCTGCAGTAAGG - Intergenic
964547988 3:157856381-157856403 GCAAGGTCAAGGCTAAAATAGGG - Intergenic
966208442 3:177428182-177428204 ACAAGATCAAACCTACACTATGG + Intergenic
968857041 4:3133421-3133443 CAGAGATCAAGGCTGCAGTAAGG + Intronic
969118477 4:4889345-4889367 CCAAGATCAAGGCTCCAGCATGG - Intergenic
970586910 4:17523137-17523159 GGAAGGTCAAGGCTCCAGTGGGG - Intronic
971304402 4:25467167-25467189 GGAAGAGGAAGGCTACAGGAAGG - Intergenic
972598040 4:40547471-40547493 CCAAGATCAAGGTGACAGCAGGG - Intronic
973044719 4:45521540-45521562 CCAAGATCAAGGATCCAGAAGGG + Intergenic
974088995 4:57291122-57291144 CCAAGATCAAGGTTCCAGCAGGG + Intergenic
974123242 4:57664953-57664975 CCAAGATCAAGGTGTCAGTAGGG - Intergenic
974363413 4:60913802-60913824 AGAAGATCAAGTCCACAGTAAGG + Intergenic
976147653 4:82057991-82058013 GAAGGAACAAGGCTACAGGAGGG - Intergenic
977716038 4:100184946-100184968 GAAAGACCAAGGCTATATTAGGG - Intergenic
978795361 4:112703197-112703219 CCAAGATCAAGGTAACAATAGGG - Intergenic
979704326 4:123703502-123703524 CCAAGATCAAGGTGCCAGTAGGG - Intergenic
980434153 4:132747397-132747419 CCAAAATTAAAGCTACAGTAGGG + Intergenic
982286661 4:153743302-153743324 GCAAAGTCAAGGCTGCAGCATGG + Intronic
983176226 4:164590955-164590977 TCAAGATCAAGGCGTCAGCAGGG - Intergenic
984821646 4:183887814-183887836 ACGAGCTCAAGGCTACAGTGAGG - Intronic
985534327 5:455123-455145 GCACTGTCAAGGCTACAGAATGG - Intronic
986175782 5:5350800-5350822 GCCAGAGAAAGGCTACAGTAGGG + Intergenic
986231561 5:5868935-5868957 TCAAGATCAAGGCATTAGTAGGG + Intergenic
986326747 5:6681381-6681403 CCAAGATCAAGGTTCCAGCAGGG + Intergenic
987999008 5:25326088-25326110 GCAAGGCCAAGTCTACAGGATGG + Intergenic
988681832 5:33491027-33491049 GGGAGGTCAAGGCTGCAGTAAGG - Intergenic
989382864 5:40826413-40826435 GCCATATCAAGGATACAGAAGGG + Exonic
992432997 5:76727958-76727980 GGGAGATCGAGGCTACAGTGAGG - Intronic
993353253 5:86875911-86875933 GGGAGGTCAAGGCTGCAGTAAGG + Intergenic
993574394 5:89583669-89583691 CCAAGATCAAGGTGACAGCAGGG + Intergenic
996506732 5:124276341-124276363 CCAAGATCAAGGCACCAGCATGG + Intergenic
996846454 5:127904250-127904272 CTAAAATCAAGGTTACAGTAAGG - Intergenic
997269051 5:132520263-132520285 CCAAGATCAAGGTGCCAGTAAGG - Intergenic
1002048478 5:176555489-176555511 GCAAGAGCAGGGCTATAGTTTGG - Intronic
1003856971 6:10286423-10286445 CCAAGATCAAGGTGTCAGTAGGG - Intergenic
1003998686 6:11571256-11571278 AGAAGTTCAAGGGTACAGTAAGG - Intronic
1004043532 6:12006177-12006199 TCAAGATCAAGGCATCAGCAGGG - Intergenic
1008776230 6:55041304-55041326 TCAAGATCAAGGTATCAGTAGGG - Intergenic
1011720532 6:90151355-90151377 GGGAGGTCGAGGCTACAGTAAGG - Intronic
1011771632 6:90679695-90679717 GCAAGATCAAGGGGTCAGCAGGG + Intergenic
1013104521 6:107015310-107015332 ACAAGGTCAAGGCTGCAGTGAGG + Intergenic
1013584952 6:111570186-111570208 CCAAGATCAAGGTTTCAGCAGGG - Intronic
1013617121 6:111853921-111853943 GAAAGATCAAGACTAGAGAAGGG + Intronic
1015919556 6:138253430-138253452 TCAAGATCAAGGCGTCAGTGGGG + Intronic
1016475656 6:144424226-144424248 CCAAGATCAAGGCATCAGCAGGG + Intronic
1017711534 6:157173131-157173153 GGAAGAACAAGACTAGAGTAAGG - Intronic
1022055954 7:26734620-26734642 CCAAGATCAAGGCACCAGCAGGG + Intronic
1023370430 7:39507542-39507564 TCAAGATCAAGGCATCAGCAGGG - Intergenic
1024995910 7:55273086-55273108 CCAAGATCAAGGTTCCAGCAGGG - Intergenic
1025825573 7:65007927-65007949 ACGAGTTCAAGGCTACAGTGAGG + Intergenic
1034940825 7:155229075-155229097 CCAAGATCAAGGCGTCAGCAGGG + Intergenic
1035097935 7:156371229-156371251 CCAAGATCAAGGTGTCAGTAAGG + Intergenic
1037076708 8:14729598-14729620 GCAAGATCAAGGTGCCAGCAAGG - Intronic
1039863174 8:41477163-41477185 TCAAGATCAAGGCATCAGCAGGG - Intergenic
1040299713 8:46181535-46181557 GCAAAAACAAGGCCACAGTGTGG - Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1040963465 8:53060488-53060510 ATAAGATTAAGTCTACAGTAAGG - Intergenic
1040987633 8:53313949-53313971 CCAAGATCAAGGCACCAGCATGG + Intergenic
1044718153 8:95120257-95120279 GCAATATCAAGTCTAGAGTGAGG - Intergenic
1045718544 8:105078001-105078023 CCAAGATCAAGGTTCCAGCAGGG + Intronic
1046144700 8:110143100-110143122 GCAAGGCCAAGGCTGCAGTGGGG - Intergenic
1047768576 8:128011534-128011556 GCAAGATCAAGGTGCTAGTATGG - Intergenic
1048023295 8:130560395-130560417 CCAAGATCAAGGGGACAGCAGGG - Intergenic
1050523664 9:6527326-6527348 GGAAGAAAAAGGCCACAGTAAGG + Intergenic
1051164613 9:14248341-14248363 GGGAGACCAAGGCTACAGGAAGG - Intronic
1051206968 9:14698250-14698272 GCAAGTTCAAGGTTGCAATATGG + Intergenic
1053605223 9:39651350-39651372 CCAAGATCAAGGCATCAGCATGG + Intergenic
1053863142 9:42407977-42407999 CCAAGATCAAGGCATCAGCATGG + Intergenic
1054248318 9:62691065-62691087 CCAAGATCAAGGCATCAGCATGG - Intergenic
1054562432 9:66725591-66725613 CCAAGATCAAGGCATCAGCATGG - Intergenic
1056036855 9:82615916-82615938 CCAAGATCAAGGTATCAGTAGGG + Intergenic
1056630324 9:88288084-88288106 GCCAGCACAAGGCAACAGTAAGG + Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1186334924 X:8576034-8576056 GGGAGTTCAAGGCTACAGTGAGG + Intronic
1186891782 X:13966214-13966236 GCAGGATCAAGGTTACAGCCTGG + Intergenic
1189170230 X:38901851-38901873 CCAAGATCAAGGCACCAGCATGG - Intergenic
1189302744 X:39964344-39964366 CCAAGATCAAGGTGTCAGTAGGG + Intergenic
1190155759 X:47991312-47991334 CCAGGATCAAGGCACCAGTAGGG - Intronic
1190166479 X:48076976-48076998 CCAAGATCAAGGTTCCAGAAAGG - Intergenic
1190978793 X:55435463-55435485 TAAAGATCAAGGATACAGAAAGG + Intergenic
1192594196 X:72388889-72388911 CCAAGATCAAGGCACCAGCATGG - Intronic
1193894271 X:87092713-87092735 CCAAGATCAAGGTGTCAGTAAGG - Intergenic
1194387957 X:93279910-93279932 TCAAGGTCAAGGATACAGAACGG + Intergenic
1194446630 X:93995349-93995371 GAAAGATCAAGGGTTCAGTTTGG + Intergenic
1195199536 X:102534361-102534383 CCAAAATCAAGGATACAGAAAGG + Intergenic
1195593498 X:106660496-106660518 GCAATAGCAAGGTTTCAGTATGG - Intronic
1198277922 X:135113539-135113561 CCAAGATCAAGGCGCCAGCATGG - Intergenic
1198520993 X:137452219-137452241 TCAAGATCAAGGTGACAGCATGG + Intergenic
1202603113 Y:26614673-26614695 GAAAGAGCAATGCCACAGTAGGG + Intergenic