ID: 1107365885

View in Genome Browser
Species Human (GRCh38)
Location 13:39674875-39674897
Sequence AGTTTCAGGCATCCACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 17, 2: 46, 3: 112, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107365885 Original CRISPR AGTTTCAGGCATCCACTGGA GGG Intronic
903685521 1:25128892-25128914 ATCTTCAAGCATCCTCTGGATGG + Intergenic
903771888 1:25769522-25769544 AGGTCCAGGCTTCCTCTGGAGGG - Intronic
904519560 1:31084206-31084228 AGTTTCAGGCATTCACTGGGAGG - Intergenic
904910073 1:33928026-33928048 AGGTGCAGGCATCCCCTGCATGG - Intronic
906428857 1:45738088-45738110 AGTTTCAGGCATCCACTGGGGGG + Intronic
906758142 1:48341893-48341915 GGTTTCAGGCATCCACTAAGGGG + Intronic
909358464 1:74734608-74734630 GGTTTCAGGCATCCACTAGGGGG + Intronic
909580152 1:77224269-77224291 GATTTCAGGTATCCACTGGGGGG - Intergenic
910415880 1:86997672-86997694 GGTTTCAGGCATCTACTGGGGGG - Intronic
912189269 1:107318710-107318732 ACTTTCATGCATCCAATGGGGGG + Intronic
912871068 1:113307144-113307166 GGTTTCAGGCAACCACTGGGGGG - Intergenic
912891898 1:113542145-113542167 GGTTTCCGGCATCCACTGGGGGG - Intronic
913488092 1:119352292-119352314 AGTTTTAGGCATCCACTGGGAGG + Intergenic
913584167 1:120256964-120256986 AGTTTGAGGCATCCAAAGGAGGG - Intergenic
913624013 1:120641376-120641398 AGTTTGAGGCATCCAAAGGAGGG + Intergenic
914566158 1:148868832-148868854 AGTTTGAGGCATCCAAAGGAGGG - Intronic
914606663 1:149261408-149261430 AGTTTGAGGCATCCAAAGGAGGG + Intergenic
914829034 1:151157248-151157270 AGGTTCAGGTTTCCACTGGAAGG + Intronic
916018977 1:160776445-160776467 ATGTTCAGTCATCCACTGTAGGG + Intergenic
917521137 1:175749326-175749348 AGTTACAGGCAGGCACTGGCTGG + Intergenic
917857795 1:179115663-179115685 GGTTTCAGGCATCCAAGGGGGGG + Intronic
918650922 1:186962305-186962327 AGTTTCGCACATCCACTGGGGGG + Intronic
918991934 1:191708053-191708075 AGTTTCAGCAATTCACTAGAAGG + Intergenic
919110346 1:193211161-193211183 GGTTTCAGGTATCCGCTGGGGGG - Intronic
919340573 1:196301397-196301419 AGTTTCAGCAAACCTCTGGAGGG + Intronic
920004514 1:202823194-202823216 AGTTCTAGGCATGGACTGGAGGG + Intronic
920552287 1:206872651-206872673 AGCTTCAGGTATCCCCTGAATGG - Intergenic
920986235 1:210892259-210892281 AGTTTCAGGCATCCAGGGAATGG - Intronic
921912059 1:220560290-220560312 AGTTTCAGCCATCCACTGGGGGG - Intronic
921990122 1:221356870-221356892 AGTATTAGGCATCCACTAGGGGG + Intergenic
922307322 1:224355811-224355833 CGTGTCAGGCATCCACTTGGGGG + Intergenic
923453321 1:234140506-234140528 AGTTTCACCCATCCAGTGGGGGG + Intronic
923746541 1:236705925-236705947 AATTTCAGGCTTCCACTGCCAGG - Intronic
924863183 1:247948745-247948767 AGTTTCAAACATCCACTGGGGGG + Intronic
924866655 1:247990155-247990177 AATTTCAGGCATTCACTGGCGGG + Intronic
1065010191 10:21414115-21414137 GGTTTCAGACTTCCACTGGGGGG - Intergenic
1065436908 10:25712189-25712211 GGTTTCAGGCATCCACTAGTGGG + Intergenic
1065455836 10:25905822-25905844 GGTTTCAGGCATTCACTGGGGGG + Intergenic
1065591662 10:27268553-27268575 AGTTACAGGCTTCAACTGGTGGG + Intergenic
1065659350 10:27989643-27989665 AGTTACAGGCTTCAACTGGTAGG - Intronic
1068161437 10:53270283-53270305 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1068338187 10:55665628-55665650 GGTTTCAGGCAGCCACTGGGGGG + Intergenic
1069300377 10:66900042-66900064 AGAGTCAGGGATCCACTTGAGGG - Intronic
1069415580 10:68197797-68197819 AGTTTCAGGCATTCACTGTGGGG - Intronic
1069778060 10:70938235-70938257 AGTTTCCGGCATCCTCAGGTGGG + Intergenic
1070088766 10:73262725-73262747 TGTTACAGGTATCCACTGGGGGG + Intronic
1070507106 10:77123641-77123663 GGTTTCAGGCATCCACTGGGAGG - Intronic
1073842821 10:107517568-107517590 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1073917236 10:108419795-108419817 GGTTTCAAGCATCCACTGGGGGG - Intergenic
1074065615 10:110009993-110010015 AGTTTCAAGCATTGACTGAAAGG + Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1074850547 10:117436118-117436140 AGTTTCAACCTTACACTGGAAGG - Intergenic
1075799193 10:125142243-125142265 AGTCTCAGGCATCCCTAGGATGG + Intronic
1076511113 10:131014347-131014369 AGATTCTGGCACCCACTGCACGG + Intergenic
1076758077 10:132585538-132585560 CGTTACAGGCGTCCACTGGGGGG + Intronic
1077293612 11:1813339-1813361 AGTGTCCAGCATCCACTGGGGGG - Intergenic
1079861102 11:25672213-25672235 AGCTTCAGGCATCCACTGACAGG + Intergenic
1081959822 11:47127500-47127522 CGTTTCAGCCACCCACTGGCTGG + Intronic
1081982519 11:47277155-47277177 GGTTTGAGGCATCCACTGGTGGG - Intronic
1084034423 11:66499967-66499989 GGCTTCAGGCATCCACTACATGG + Intronic
1084759025 11:71256587-71256609 AGTTTCGGGCATCCACTGGGGGG - Intergenic
1087217153 11:95506483-95506505 TGTTTCAAGCATCCACTGGGGGG + Intergenic
1087762953 11:102121689-102121711 TGTTTCAAGCATCCACTGTGGGG + Intronic
1088284703 11:108175309-108175331 AATTTCAGGCACCCACTGGGGGG + Intronic
1088760380 11:112923705-112923727 GGTTTCAGGCATCCACTGAGGGG - Intergenic
1088832411 11:113548624-113548646 AGTTTCAGGCATCCACTGGGGGG + Intergenic
1089867967 11:121648530-121648552 AGTTTCAGGCATCGAGAGGGAGG + Intergenic
1090622669 11:128575119-128575141 GGTTTCAGGCCTCCACTGGAGGG - Intronic
1091140422 11:133229707-133229729 AGCTTCAGGCATCCTCTGGGGGG + Intronic
1091496218 12:975185-975207 GGTTTCAATCATCCACTGGGAGG + Intronic
1091700752 12:2659958-2659980 AGTTTCTGGCAGCCACTGGCTGG - Intronic
1092894410 12:12999181-12999203 CGTTTCAGGTATCCACTGGGGGG - Intronic
1095994868 12:48072854-48072876 GGTTTCAAGCATCCACTGGTGGG + Intronic
1096256343 12:50064309-50064331 AGTTGCAGGAATCCAGTGGGTGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1097317550 12:58188177-58188199 AGTTTCTGGAATCTTCTGGAAGG + Intergenic
1097391463 12:59020190-59020212 AGTTTCTGGCAGCCAGTGGCTGG - Intergenic
1097413160 12:59280908-59280930 AGTTTCTGGCATCCACTAACAGG + Intergenic
1098850100 12:75585983-75586005 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1099352304 12:81588915-81588937 TGTTTCAGGTATCATCTGGAGGG - Intronic
1099756870 12:86862746-86862768 GGTTTTAGGCATCCACTGGGAGG - Intergenic
1100877080 12:98973974-98973996 AGTTTCAGGCATCCACTGGGTGG + Intronic
1101289230 12:103350613-103350635 AGTTTCAGTCGTCCACTGGGAGG + Intronic
1101472912 12:105015733-105015755 TGTTTCAGGCATCCTCTGGGGGG + Intronic
1102800020 12:115723981-115724003 AATTTCAGGCATTTACTAGAAGG + Intergenic
1104262186 12:127194410-127194432 AGTTCCAGGCATCCAGTGTGTGG - Intergenic
1104448334 12:128850859-128850881 AGCTTCAGTCAGCCACAGGATGG + Intergenic
1104800087 12:131548490-131548512 GGTTTCAGGCATCCACTGGGGGG - Intergenic
1105401503 13:20100169-20100191 GGTTTCTGACATCCACTGGGGGG - Intergenic
1106453254 13:29903704-29903726 AGTTACAGGAATCATCTGGAGGG + Intergenic
1106615870 13:31327077-31327099 GGTTTCAAACATCCACTGGGGGG - Intronic
1107365885 13:39674875-39674897 AGTTTCAGGCATCCACTGGAGGG + Intronic
1108465393 13:50709904-50709926 GGTTTCAGGCATCCACTGGGAGG - Intronic
1110617110 13:77553609-77553631 AGTGTCAGGGATCCCCTGGCTGG - Intronic
1112073466 13:95881234-95881256 GGTTTCAGGTATCCACTGAGTGG + Intronic
1113659117 13:112092691-112092713 AGTTTCAGAAATCCACAGGGAGG - Intergenic
1113716693 13:112514273-112514295 GGTTTCAGGCATCCATGGGGTGG + Intronic
1114988618 14:28261719-28261741 AGTTTCAGACGTCCCTTGGATGG + Intergenic
1115483178 14:33882859-33882881 AGTTTCAGGCATCCATGGTGGGG + Intergenic
1115801827 14:37003059-37003081 GGTTTCAGGCATCCGCTGGGGGG - Intronic
1118380164 14:65211641-65211663 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1118411019 14:65478249-65478271 GGTTTCAGGTATCCACTGGGGGG - Intronic
1118479828 14:66153263-66153285 ACTTGCAGCCATCCCCTGGAAGG - Intergenic
1118795266 14:69137970-69137992 AGTTGCAGGCATCCACTGCGGGG + Intronic
1120070287 14:80095122-80095144 ATTTTCAGGCATTCACTGGGGGG + Intergenic
1120716653 14:87847840-87847862 TGTTTCAAACATCCAGTGGAGGG - Intronic
1121103629 14:91266232-91266254 AGTTTCTGGACTTCACTGGAGGG + Intergenic
1121722705 14:96121893-96121915 AGTTTCAAGCATCCACTGGGAGG - Intergenic
1123783937 15:23650044-23650066 AGTTTCAGGCCTCCACAGGGGGG + Intergenic
1123895847 15:24829287-24829309 AGTTTCAGGCCTGGACTGGGTGG + Intronic
1124570572 15:30859474-30859496 TGTTTCAGGCGGCCACTAGAGGG - Intergenic
1125213663 15:37244342-37244364 GGTTTCAGGCATCCGCTGGGGGG + Intergenic
1125361404 15:38868104-38868126 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1125877301 15:43161115-43161137 GTTTTCAGGCATCCACTGGGGGG + Intronic
1126028176 15:44469181-44469203 GGTTTCAGACAACCACTGGAGGG + Intronic
1126486743 15:49189426-49189448 GGTTTCAGGCATCTACTGAGGGG - Intronic
1127201596 15:56659618-56659640 AGTTTCAGGCGTTCACTGGGGGG + Intronic
1127542769 15:59958708-59958730 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1128604261 15:69024751-69024773 AGTTTCAGGCATCCACTAAGGGG + Intronic
1130658507 15:85810845-85810867 CGTTTCAGGCATTCACTGGGGGG + Intergenic
1130767302 15:86883940-86883962 AGTTTCAGGCATCCACTGGGGGG - Intronic
1131409062 15:92190648-92190670 AGTTTCTGGCATCCACTGGGGGG - Intergenic
1131602290 15:93861933-93861955 GGTTTCTGGCAACCACTGCAGGG + Intergenic
1132227115 15:100151136-100151158 AGGTACAGGCATCCAGTGGGAGG + Intronic
1132488458 16:210619-210641 AGATTCAGGGATTCACTCGAGGG + Intronic
1134326805 16:13215023-13215045 AGTTGCAGACACCCACTGGAAGG + Intronic
1134387816 16:13790386-13790408 GGTTTCCGGCACCCACTGGGGGG - Intergenic
1136176202 16:28518652-28518674 GGTTTCAGGCATCCACTGCGGGG + Intergenic
1138796315 16:59973872-59973894 GGCTTCAGGCATCCCCTGGGGGG - Intergenic
1139808779 16:69594062-69594084 AGTTTTGGGCATCCACTAGAGGG - Intronic
1143237125 17:5412482-5412504 AGTTTCAGGCATTCACTGGGGGG + Intronic
1143320322 17:6064340-6064362 GGGATCAGCCATCCACTGGAAGG - Intronic
1143573132 17:7773499-7773521 GGTGTCAGGCATCTACTGGGGGG - Intronic
1145066957 17:19767958-19767980 GGTTTCAGACATCCACTGGGGGG + Intergenic
1145711191 17:26980090-26980112 ATTTTAAGGAATCCACTGAATGG + Intergenic
1145937026 17:28720286-28720308 AGCTACATGCATCCACTGGTTGG + Intronic
1149455749 17:56786647-56786669 GGTTTCAGACATCCACTGGGGGG - Intergenic
1149710783 17:58740210-58740232 GGTTTCAGGTATCCACTGGGGGG - Intergenic
1149881414 17:60295866-60295888 GGTTTCAGACATCCACTGGGAGG + Intronic
1150171720 17:63003376-63003398 CATTTCAGGCATCCACTGTGGGG - Intergenic
1151152627 17:72100937-72100959 CGTTTCAGGCAGCGATTGGAAGG + Intergenic
1151274278 17:73022255-73022277 ACTTGCAGGCATCCACAGAATGG + Intronic
1152274421 17:79347909-79347931 AGTAGCAGACTTCCACTGGAGGG - Intronic
1153593109 18:6695584-6695606 AGTTTTAAGCATCCAGTGGGGGG - Intergenic
1154285197 18:13048743-13048765 GGTTTCAGGTATCCACTTGGAGG + Intronic
1154953306 18:21230757-21230779 TGTTTTAGGCATCCACTGGGGGG + Intergenic
1155124965 18:22864953-22864975 AATTTCAAGCATCTACTGGAGGG - Intronic
1155629986 18:27882014-27882036 GGTTTTCGGCATCCACTGGAGGG + Intergenic
1155882964 18:31172818-31172840 AGTTTCAGCACTCCACTGGTGGG - Intergenic
1156312149 18:35934584-35934606 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1157818451 18:50748325-50748347 AGCCTCAGGCAGCCACAGGAAGG - Intergenic
1157860387 18:51135899-51135921 GGTTTCAAGCATCCACTAGGGGG + Intergenic
1157966994 18:52219435-52219457 AGTTCCAAGCATCCACTGGGGGG + Intergenic
1158214960 18:55090890-55090912 AGTTTCAGGCATTTACTAGGGGG - Intergenic
1159464429 18:68762887-68762909 GGTTTTAGGCATCCACTGGAGGG + Intronic
1159772118 18:72558478-72558500 AGGTTCAAGGATCCACTAGAAGG - Intronic
1162762038 19:12894154-12894176 AGTTTCTGGCAGCCAGTGGCTGG - Intronic
1165171262 19:33893468-33893490 AGTTTCAGCCATCCAGTTGTAGG + Intergenic
1165897635 19:39152769-39152791 AGTTTCAGGCATCCCATTGGGGG + Intronic
1167525065 19:49978586-49978608 AGTGTCCGTCATCCACAGGAAGG + Intronic
1167704377 19:51070296-51070318 AGTTTCAGTGATTCACTAGAAGG + Intergenic
1167822738 19:51943707-51943729 AGTTTCAGGCATCCATGGTGTGG + Intronic
1168683016 19:58329812-58329834 GGTTTCAGGCATCCACTGGAGGG + Intronic
925085611 2:1105308-1105330 GGTTTCAGGCATCTGCTGCAGGG + Intronic
927170303 2:20363767-20363789 AGTTTCAGCCAGCCACATGATGG - Intergenic
928058047 2:28078566-28078588 GATTTTAGGCATCCACTGGCAGG + Intronic
930347864 2:50208145-50208167 AAATTCAGTCTTCCACTGGAGGG - Intronic
930405985 2:50956333-50956355 AATTTCAAGCATCCACTGGGGGG + Intronic
930612560 2:53559458-53559480 TGTTTCAGGCATCTACTGTGGGG - Intronic
932684772 2:73858920-73858942 GATTTCAGGCATCCATTGGGGGG - Intronic
932855032 2:75224744-75224766 AGTTTCAGGCAACCAGTGGCTGG + Intergenic
933385613 2:81607029-81607051 AGTTTTAGGTATCAACTTGACGG - Intergenic
933670604 2:85003946-85003968 AGGTTCAGGCATCCACTGGGTGG - Intronic
934118457 2:88817448-88817470 GGATTCAGGCATCCCCTGGGGGG + Intergenic
934540686 2:95171881-95171903 AGGTTCAGGGATTCACTAGAAGG + Intronic
936098811 2:109556485-109556507 AGTTTGAGGCATGTACAGGAGGG + Intronic
936277922 2:111116937-111116959 TGGTTCTGGCAGCCACTGGAAGG - Intronic
936471443 2:112802194-112802216 AGTTTCAGGCATTCACTGAGGGG - Intergenic
938107365 2:128542325-128542347 AGTTTCAGGCATCCACTGGGGGG + Intergenic
938616267 2:133002235-133002257 GGTTTTAGGCATTCACTGGGGGG - Intronic
939243414 2:139592243-139592265 GGTTTTAGGCATCCACTGGGGGG + Intergenic
940755005 2:157671903-157671925 GGTTTCAGGCATCCACTGGAGGG - Intergenic
942408134 2:175677135-175677157 GGTTTCAGGCATCCACTGGAGGG - Intergenic
943671685 2:190668816-190668838 AGTTTCAGGCATCCAACTGGGGG - Intronic
945220898 2:207483361-207483383 AGTTTTAGGAACCCACTGGCTGG - Intergenic
945528359 2:210918614-210918636 GGTTTCAGGCACCCAATGGGGGG - Intergenic
945665432 2:212735411-212735433 AGTTTCAGGCATTCACTGGGGGG - Intergenic
947448580 2:230183955-230183977 GGTTTCAGGCATCCACTGGAGGG - Intronic
947983978 2:234433598-234433620 AGTATGAGACATCCACTAGAGGG + Intergenic
1169187189 20:3628653-3628675 GGTTTCACGCATCCACTGGGAGG + Intronic
1169254434 20:4086230-4086252 AGTTCCAGGCAGGCCCTGGAAGG + Intergenic
1169887708 20:10419517-10419539 AGTTTCAGGCATCCACTGGGTGG - Intronic
1170446975 20:16438510-16438532 AATTTCAGGCAACCACTGGAGGG + Intronic
1170758199 20:19223489-19223511 GGTTTCGGGCATTCACTGGGAGG - Intronic
1170908637 20:20541264-20541286 AGTTTCAGTCATCCACTGAGGGG - Intronic
1172295447 20:33807341-33807363 GTTTTCAGGCATCCACTTGCAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173173148 20:40743397-40743419 AGTTACTGGTACCCACTGGAGGG + Intergenic
1173699798 20:45059043-45059065 AGTTTCAGGTGTCCAGTGGGGGG - Intronic
1174297703 20:49560881-49560903 CGTGGCAGGGATCCACTGGAGGG + Intronic
1175272561 20:57745022-57745044 TGAGTCAGGAATCCACTGGAAGG + Intergenic
1175547052 20:59785129-59785151 CGTTTCAGGCATCCACTCTGTGG - Intronic
1176378595 21:6100414-6100436 CACTTCAGGCAGCCACTGGAAGG - Intergenic
1179744880 21:43437823-43437845 CACTTCAGGCAGCCACTGGAAGG + Intergenic
1181382629 22:22518986-22519008 AGTTTCAAGCATCCACTTCGGGG - Intronic
1181849279 22:25738433-25738455 AGTTTCAGACATCCACTGGGAGG - Intergenic
1182218227 22:28737152-28737174 GGTTTCAGGCATCCACTGGGGGG - Intronic
1183136188 22:35890319-35890341 AGTTTCAGGCATCTACTTGGGGG - Intronic
1183817989 22:40319831-40319853 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1183834212 22:40438814-40438836 AGTTTCAGATATCCACTAGGGGG + Intronic
1184868511 22:47218461-47218483 AACTTCAGGCAGCCACTGGGGGG - Intergenic
949183170 3:1159212-1159234 GGTTGTAGGCATCCACTGGGAGG - Intronic
950820631 3:15754609-15754631 GGTTTCAGGCATCTACTTGGGGG + Intronic
950986763 3:17379672-17379694 AGTTTTAGGCATCTACTGGGAGG - Intronic
951233092 3:20202227-20202249 GTTTTCAGGCATCCACTAGTAGG - Intergenic
951922986 3:27876280-27876302 AGCTTCAGGCATCCACCTGGGGG + Intergenic
951957062 3:28269167-28269189 AGTGTCAGGCATCCACTAGGGGG + Intronic
952077140 3:29711033-29711055 GATTTCAGGCATCCACTGGGGGG - Intronic
952291785 3:32023758-32023780 AGTTTCAGGTATCCACTGAGGGG - Intronic
952712570 3:36446097-36446119 AGTTTCAGGCATCAAGTCCAAGG - Intronic
952783737 3:37131104-37131126 AGTTTCAGGCATCTGCTGGGGGG + Intronic
952863572 3:37835151-37835173 AGTTTCAGGCATCCACTGGTGGG + Intergenic
953450976 3:43005942-43005964 GGTTTCAGGCATCCGCTGGGGGG + Intronic
954593537 3:51804727-51804749 GGTTTCTGGCTTCCTCTGGAAGG + Intergenic
955107213 3:55909609-55909631 AGGTTCAGGCAGCCATGGGAGGG + Intronic
955865720 3:63381811-63381833 TGTTTCAGTAATCCACAGGAAGG - Intronic
956758416 3:72413650-72413672 AATTTCAGGCATCCACTGGGTGG + Intronic
956971573 3:74532357-74532379 AGTTTCAAGCATCCACCAGGGGG - Intergenic
957553348 3:81735097-81735119 AGTTTCAGGCATCCACTTGGGGG + Intronic
957796387 3:85014512-85014534 GGTTTCAGGCATCTCCTGGAGGG + Intronic
957904498 3:86539408-86539430 AGTTGGAGTCATTCACTGGAAGG - Intergenic
958004798 3:87797252-87797274 GGTTTCAGGCATTCACTGGGGGG + Intergenic
958030955 3:88109077-88109099 GGTTTCAAGCATCCAGTGGGAGG + Intronic
958879916 3:99658166-99658188 GGTTTCAGGACTCCAGTGGAAGG - Intronic
959156554 3:102673672-102673694 AGTGTCATGCAGCCACTAGATGG + Intergenic
959617191 3:108361677-108361699 GGTTTCAGGCATCCACTTGGGGG + Intronic
960428038 3:117533153-117533175 GGTTTTAAGCATCCACTGGGGGG - Intergenic
960887490 3:122411066-122411088 AGTTTCAGGCATCTACTGGGGGG + Exonic
961965184 3:130894400-130894422 AGGTTCGGGTATCCCCTGGATGG + Intronic
962286972 3:134094348-134094370 AGTTTCAGGCATCCATAGGGAGG - Intronic
963578304 3:147091478-147091500 AGTCTCAGGGATCCACAGGTGGG + Intergenic
963641279 3:147863919-147863941 AGGTTCAGACAGACACTGGAAGG + Intergenic
964268748 3:154931644-154931666 ATTTTCATGCATACAGTGGAAGG + Intergenic
964480291 3:157132496-157132518 AGTACCAGGCATCCACAGAAGGG + Intergenic
964986856 3:162752788-162752810 AGTTGCAGCCATCCTCTTGAGGG - Intergenic
965093104 3:164186366-164186388 TGTTTCAGCCACCCAGTGGATGG + Intergenic
967005894 3:185382093-185382115 AGTTTCAGGTATCTACTGGGAGG - Intronic
968565106 4:1307964-1307986 CATTTCAGGCATCAACTTGATGG - Intronic
969286750 4:6207278-6207300 AGTTTCAACCACCCAGTGGAGGG - Intergenic
969489495 4:7491021-7491043 GGTTTCAGGAAGCCACAGGAAGG - Intronic
970925553 4:21447534-21447556 TGGTTCAGGCATCCACTAGGGGG - Intronic
971084460 4:23255453-23255475 AAATTTAGACATCCACTGGAGGG - Intergenic
971400501 4:26271281-26271303 GATTTCAGGCATCCACTGGAGGG + Intronic
972311642 4:37888749-37888771 AGTTTCAACCATCCTCTGGTGGG + Intergenic
972496144 4:39636712-39636734 GGCTTTAGGCATCCACTGGGGGG - Intronic
972846766 4:43000725-43000747 GGTTTCAGGCATCCACGAGGGGG + Intronic
973831986 4:54770888-54770910 AGATTCAGGCATCCACTGGGGGG + Intergenic
974311546 4:60217087-60217109 AGTTTCAGACATCCATTGTGGGG + Intergenic
974429255 4:61774853-61774875 TGTTTCAGGCATCCACTGGGGGG + Intronic
974652139 4:64767854-64767876 AGTTTCTGGCAGCCAGTGGCTGG + Intergenic
975393771 4:73852221-73852243 GGTGTCAGGGACCCACTGGATGG - Intergenic
975483581 4:74909421-74909443 ATTTTCAGGATTCAACTGGATGG + Intergenic
976907404 4:90257014-90257036 AGTTTCAGGCATCCACTGCGGGG + Intronic
977534652 4:98242929-98242951 GGTTTCAGGCATCCACTGGGGGG + Intergenic
978081391 4:104596625-104596647 AGTTTCAGGGATCACCTGGGGGG + Intergenic
978563545 4:110058472-110058494 GGTTTCTGGCTTCCAGTGGAAGG + Intronic
979851128 4:125572757-125572779 TGTATCATGCATCCATTGGATGG + Intergenic
979968533 4:127106338-127106360 GGTTTCAGGTATCCCCAGGAAGG + Intergenic
980221948 4:129929252-129929274 GGTTTCAGGCATCCACTAGGGGG + Intergenic
980245319 4:130231506-130231528 AGTTTCAGGTATCCACTTGGAGG - Intergenic
981714724 4:147741542-147741564 ATTTTCAGGCAGGGACTGGATGG + Intronic
981823279 4:148910890-148910912 AGTTTTAGGCATACAGTTGATGG - Intergenic
982151219 4:152459641-152459663 GGTTTCAAGCATCCACTGGGGGG - Intronic
982271081 4:153589107-153589129 AGTTTCAGGCATCTACGGTGGGG - Intronic
982338290 4:154265877-154265899 AGTTTCAAACATTCACTGGGGGG - Intronic
983378110 4:166956173-166956195 GGTTTCAGGCATCTACTGGGGGG - Intronic
984745761 4:183215059-183215081 GGCTTCAGGCATCCACTGGGGGG - Intronic
985103816 4:186482894-186482916 AGTTCCAGGCCATCACTGGAAGG + Intronic
985226539 4:187767385-187767407 AGTTACAGGCTTCCATTGGTGGG + Intergenic
990168433 5:53020024-53020046 TGTTTTAGGCATCTACTGGAGGG + Intronic
991132668 5:63142348-63142370 AATTTCAGCCATCCACTGGGGGG - Intergenic
991229675 5:64317688-64317710 TGCTTCAGGCATCCACTGGGGGG - Intronic
994228171 5:97279155-97279177 GGTTTCAGGCATCCACTGAGGGG + Intergenic
994410515 5:99402270-99402292 GGTTTCAGGCATCCACTGGGGGG - Intergenic
994483310 5:100362999-100363021 GGTTTCAGGCATCCACTGGGGGG + Intergenic
995424395 5:112004075-112004097 AGTTTTAGGCATCCACTGGGAGG - Intergenic
997960239 5:138315377-138315399 AATTTTAGGCATCCACTGGGGGG + Intronic
998080100 5:139267945-139267967 TCTCTCAGGCATCCACTTGATGG - Intronic
999770564 5:154772493-154772515 AGTTTCAAGCATCTACTGGAGGG - Intronic
999990433 5:157045027-157045049 GGTTTCATGCATCTACTTGAGGG - Intronic
1000260611 5:159585017-159585039 AAGTTCAGGCCTCCACTGCAGGG - Intergenic
1000883486 5:166723610-166723632 AGTTTCAAGCATCCACTGGGGGG + Intergenic
1001060497 5:168484265-168484287 GGTTTCAGGCATCCACTGAGGGG + Intergenic
1001886762 5:175299193-175299215 AGGTTCAGGCATACATAGGAAGG - Intergenic
1003748174 6:9025235-9025257 AGTTCCAGGCTTCCACAGTATGG - Intergenic
1004101133 6:12612971-12612993 AGCTTCAGGCATTAACTGGAAGG + Intergenic
1004104701 6:12655031-12655053 AGGTTCAGTGATTCACTGGAAGG - Intergenic
1004663538 6:17730578-17730600 GGTTTCAGGCATCCTCTGGGGGG + Intergenic
1005392872 6:25350937-25350959 AATTTCAGGCATTCATTGGATGG + Intronic
1006997285 6:38273291-38273313 GGATTCAGTCATCCACTGGGGGG - Intronic
1007602661 6:43092537-43092559 GGTTTTAGGCATCCACTGGGGGG + Intronic
1008746880 6:54682303-54682325 AATTCCAGGCTTCCACTGGGAGG + Intergenic
1009842011 6:69089809-69089831 AGTTACTGGCATCCAGTGGGTGG - Intronic
1010806964 6:80248693-80248715 AGTTTAAGGTATCCAGTGGCTGG + Intronic
1011046738 6:83092599-83092621 AGTTTCAGGCATCCATTAGGGGG - Intronic
1012525781 6:100176422-100176444 AGTGTCAGGTATCAACTGGTGGG - Intergenic
1012733813 6:102913848-102913870 GATTTCAGGCACCCACTGCATGG + Intergenic
1013253909 6:108363918-108363940 AGTCTCAGTCATCCACTGATTGG - Intronic
1013489173 6:110628622-110628644 AATTTCAGGCATCCCCTGGGGGG + Intronic
1014158371 6:118137909-118137931 TGTTTCTGGCATCCCATGGAGGG - Intronic
1014291280 6:119561602-119561624 GGTTTTAGGCATCCACTGTGGGG + Intergenic
1014554303 6:122827209-122827231 GGTTTCAGGTATCCACTCGAGGG - Intergenic
1015250010 6:131117489-131117511 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1015541680 6:134320586-134320608 AGTTTCACGCATCCATGGGGGGG + Intergenic
1015792891 6:136981771-136981793 AGTTTTGGGCATCTACTGGGGGG - Intergenic
1018617062 6:165696526-165696548 AGTTTTAGGGATCCACTGGGGGG + Intronic
1019433328 7:1009714-1009736 AGTTCCAGGCAACCCCTGCACGG + Intronic
1019662210 7:2230971-2230993 AGTTTCAGGCATCAACTGACTGG - Intronic
1020761554 7:12273341-12273363 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1021827288 7:24568050-24568072 GGTTTCAGGTATTCACTGGGGGG - Intergenic
1022022503 7:26414421-26414443 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1023244788 7:38190080-38190102 TGTTTCAGGCATCCCCTGGGGGG - Intronic
1026832951 7:73621542-73621564 AGTTCCAGGGGTCCCCTGGAGGG - Intronic
1027697419 7:81429547-81429569 AGTTTCTGACAGCCACTGGATGG + Intergenic
1027772684 7:82427068-82427090 AGTTTCAGGCATCCACTGGGGGG + Intronic
1028257357 7:88615859-88615881 AGTTTCTGGCATCAAAAGGAAGG - Intergenic
1030125854 7:106151896-106151918 AGTGGCAGGCATACACAGGAGGG - Intergenic
1030774806 7:113521145-113521167 AATTTCAGGCATCCACTGTAGGG - Intergenic
1031376306 7:121030790-121030812 AGTTTCAGGCATCCACTTGAGGG + Intronic
1031537291 7:122950881-122950903 AGTCTCAGGCATTCACTGGTAGG - Intergenic
1032224610 7:130021239-130021261 GGTTACAGGATTCCACTGGAGGG - Intronic
1032262690 7:130349803-130349825 TGTTTCAGGCATCCGCTGAGGGG + Intronic
1032563553 7:132916967-132916989 CATTTCAGGCATCCACAGGGGGG + Intronic
1032918771 7:136522242-136522264 AGTTTCAGGCATCCACTGAAGGG - Intergenic
1033022990 7:137746021-137746043 AGTTTCAGGCATCTACTGGGGGG + Intronic
1033214727 7:139484706-139484728 AGTTTCAGGCATTCACTGGGAGG - Intergenic
1034679141 7:152915318-152915340 AGCTGCAGGCATCCTCTGAAAGG + Intergenic
1035337624 7:158140172-158140194 AGCTGCAGGCATGAACTGGATGG + Intronic
1035926533 8:3733938-3733960 AGTTTCAGGACCCCAGTGGATGG - Intronic
1036163711 8:6411797-6411819 GGATTCAGGCATCCACTGGGAGG + Intronic
1036284445 8:7431351-7431373 ATGTTCAGGAATCCAATGGATGG + Intergenic
1036337031 8:7880179-7880201 ATGTTCAGGAATCCAATGGATGG - Intergenic
1037094035 8:14961656-14961678 AGTTTCAGCCATCTACTAGTGGG + Intronic
1037164394 8:15809492-15809514 AGTTTCAGGCATCTACAGGGGGG - Intergenic
1038277417 8:26133595-26133617 AGTTCCAGCCATCCCCAGGAGGG + Intergenic
1038558046 8:28542054-28542076 AGTAACAGGAAGCCACTGGAGGG - Intronic
1040844931 8:51827591-51827613 AGGCCCAGGCATCCCCTGGAGGG + Intronic
1041137582 8:54776672-54776694 AGTATCAAGGATACACTGGAAGG + Intergenic
1041162819 8:55062192-55062214 GGTTTCAGGCACCCACTGGGGGG + Intergenic
1041591692 8:59594120-59594142 GGTTTCAAGCATCCACTGGAGGG + Intergenic
1041615109 8:59897696-59897718 AGTTTCAGGCATCCCAAAGAGGG - Intergenic
1041954106 8:63538075-63538097 GGTTTCAGGCATCCACTTGGGGG - Intergenic
1042744330 8:72090311-72090333 AGTTTCAGGCATCCACTGGGGGG - Intronic
1043038461 8:75228811-75228833 GGTTTCAGGCGTCCGCTGGGAGG + Intergenic
1044410767 8:91880300-91880322 AGTTTCAGGCCTCCGCTGGGGGG + Intergenic
1045102863 8:98862908-98862930 AGATTCAGGCATTCACTTGGTGG + Intronic
1045191090 8:99884677-99884699 AGTTTCAGTAATTCACTGGAAGG - Intronic
1045191141 8:99885379-99885401 GGTTTCAAGAATCCACTAGAGGG + Intronic
1045605418 8:103768302-103768324 AGTTTCTGGCAGCCAGTGGCTGG - Intronic
1045817376 8:106292552-106292574 GGTTTCAGGTATCCATTGGTGGG + Intronic
1046783653 8:118242616-118242638 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1048359598 8:133686495-133686517 AGTTTCAGGCATCCCCTGCGGGG + Intergenic
1049140899 8:140953194-140953216 AGTTTCAGGCATCTACTGGGGGG - Intronic
1050131203 9:2414581-2414603 AGATTCAGGCAGACTCTGGATGG - Intergenic
1051067033 9:13116978-13117000 AGTGTCAGGCATCCACTGGCGGG - Intronic
1051638259 9:19201003-19201025 AGTTTCTGGCAGCCAGTGGCTGG + Intergenic
1051655664 9:19379581-19379603 AGTTTCTGGCAGCCAGTGGCTGG + Exonic
1051754740 9:20386613-20386635 AGTTTGGGGCATCCATGGGATGG - Intronic
1052917295 9:33933194-33933216 AGGCTCAGGCACCCTCTGGAGGG + Intronic
1053658095 9:40240833-40240855 GGTTTCATGCATCCACTTGGGGG - Intronic
1054370217 9:64387108-64387130 GGTTTCATGCATCCACTTGGGGG - Intronic
1054526501 9:66135388-66135410 GGTTTCATGCATCCACTTGGGGG + Intronic
1054677847 9:67876864-67876886 GGTTTCATGCATCCACTTGGGGG - Intronic
1056091264 9:83208118-83208140 ACCTTCAGGCAGCCTCTGGATGG + Intergenic
1056596082 9:88008796-88008818 GGTTTCAGACATCCACTGGGGGG + Intergenic
1056951161 9:91041884-91041906 AGTTTCAGGCATCCCCTTTGGGG + Intergenic
1057187976 9:93068835-93068857 AGTTTCAGGCATGCACTGAGGGG - Intronic
1057672755 9:97109093-97109115 ACTCTTAGGCATACACTGGAAGG + Intergenic
1057748400 9:97770750-97770772 GGTTTCAGGCATTTGCTGGAAGG - Intergenic
1058250348 9:102687166-102687188 AAGTTCAGGCATTCACTGGGGGG + Intergenic
1059055266 9:110972634-110972656 AGTTTCAAGTATCCACTGGGGGG - Intronic
1059723873 9:116987082-116987104 AGTGTCAGGCATCCACTGGGTGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1188527534 X:31102372-31102394 GGTTTCAGGCATCTATTGGGGGG + Intronic
1188849746 X:35116988-35117010 AGTTTCAGGCATCAACTGAGGGG + Intergenic
1190225679 X:48543105-48543127 AGTTTCAGGCATCCACTCGGGGG + Intronic
1192616330 X:72626583-72626605 AGTTTCAGGAATCCACAAGGGGG - Intronic
1193539041 X:82748051-82748073 AATTTCAGGCATCCAGTTGGGGG + Intergenic
1194681124 X:96854484-96854506 GGTTTCAGACATCCACTGGAGGG - Intronic
1195335230 X:103847017-103847039 GGTTTCAGGCATCCACTGGGAGG + Intergenic
1195361279 X:104085600-104085622 AGTTTCAGGCGTCCATGGGATGG - Intergenic
1195796428 X:108653316-108653338 AGGTTCAGGCATCCAACGGGGGG - Intronic
1196991034 X:121328956-121328978 GGTTTCAGGCATCCATTGGGGGG - Intergenic
1197459357 X:126721522-126721544 ATTGTCAGGCAACCTCTGGATGG - Intergenic
1199006744 X:142708467-142708489 TGTTTCAGGTATCCACTGGGGGG - Intergenic