ID: 1107370360

View in Genome Browser
Species Human (GRCh38)
Location 13:39739244-39739266
Sequence TTGTAAAAACTGATTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107370360 Original CRISPR TTGTAAAAACTGATTTAGCT TGG (reversed) Intronic
901356904 1:8658056-8658078 CTGTAAGAACTGTGTTAGCTTGG - Intronic
903632435 1:24786264-24786286 TTCTAAAGACTGATTAAACTAGG + Intronic
904141970 1:28360761-28360783 TTTTAAAAAATTATTTGGCTGGG + Intergenic
907292061 1:53421844-53421866 TGGTCAAAACTGATTGAGATTGG + Intergenic
907301855 1:53491952-53491974 TTTTAAAAACTAATGTGGCTGGG + Intergenic
908155613 1:61349733-61349755 TTTTAAAAATTAAATTAGCTAGG - Intronic
908229682 1:62091619-62091641 TTTAAAAAAGTGATTTGGCTGGG + Intronic
908471595 1:64449327-64449349 TTGTAAAAATTCATTGAGCTGGG + Intergenic
908664927 1:66479558-66479580 TTTTAAAAACTGATTTACTCAGG + Intergenic
909198244 1:72654609-72654631 ATTTAAAAGCTGATCTAGCTAGG + Intergenic
911167903 1:94741303-94741325 TTGGAAAAACTGATTAGGGTAGG + Intergenic
911325671 1:96468736-96468758 TTGTAAAATCTGAACTAGCAGGG + Intergenic
911609689 1:99947102-99947124 TTTTAAAAACTTTTTGAGCTAGG + Intergenic
912481732 1:109986750-109986772 TTGTAAAAACTCATTAAGGCAGG + Intronic
914986865 1:152466433-152466455 ATGTAATTACTGATATAGCTAGG + Intergenic
915088960 1:153408176-153408198 TTGAACAAACTCCTTTAGCTCGG - Intergenic
915198071 1:154205177-154205199 TTGAAAAAACTGATGCAGCCGGG - Intronic
915459851 1:156063444-156063466 TTGTAAAAAAACATTGAGCTGGG - Intronic
916283058 1:163074002-163074024 TTTAAAAAACTGATTTATTTGGG - Intronic
916390963 1:164330497-164330519 TTGTTAAAATTGAGTTTGCTGGG - Intergenic
917175398 1:172229484-172229506 CTGTAGAAACTGCTTTAGCTGGG - Intronic
917239394 1:172931222-172931244 TTGTAAAATCTGAATTACTTAGG - Intergenic
917911000 1:179646058-179646080 TTGTAATAATTGAATTATCTGGG + Intronic
918987191 1:191647223-191647245 TTGTAAAAATTGATTTAAAAGGG + Intergenic
919256792 1:195136033-195136055 TTGTTAAAACTGATATAAATAGG - Intergenic
920175633 1:204099975-204099997 CTATAAAAAATGAATTAGCTGGG + Intronic
920453487 1:206078898-206078920 GTGCAAAAAGTCATTTAGCTGGG + Intronic
922639842 1:227218502-227218524 TTGTAGAATCTGCTTTAGATTGG - Intronic
924262337 1:242245028-242245050 TTGTCAATACTGATTATGCTGGG + Intronic
1063758221 10:9040736-9040758 TGGTAAAAACTCATTTATTTTGG - Intergenic
1064153255 10:12882906-12882928 TTGTCAAAACTTACTGAGCTAGG + Intergenic
1065201187 10:23314662-23314684 TTCTACAAACTGAGTGAGCTTGG - Intronic
1065673980 10:28154721-28154743 TTGGAAAATCTGAGTTAGTTGGG + Intronic
1065977559 10:30856026-30856048 TTTTTAAAACTGATTCAACTAGG - Intronic
1067860139 10:49838133-49838155 TTTTAAAAAATGATTTGGCTGGG + Intronic
1068155533 10:53192956-53192978 TTTTAAAAAGTGATATAGTTTGG + Intergenic
1068248537 10:54405982-54406004 TTGAAAAGACTGATTTGGGTTGG - Intronic
1068848716 10:61711107-61711129 GTGTGATAACTGATTTAGTTCGG - Intronic
1069436206 10:68386273-68386295 TTGGATAACTTGATTTAGCTAGG + Intronic
1070039003 10:72756272-72756294 TTTTAAAAACTGATTTTGGCCGG - Intronic
1070097973 10:73356900-73356922 TTGAAAAAACTTGTTAAGCTTGG + Intronic
1071045221 10:81365837-81365859 TGGTAAAATCTGCTTTAGGTTGG + Intergenic
1071176880 10:82937158-82937180 TTGTAAAAACTGAATTTGAGAGG - Intronic
1071674572 10:87643247-87643269 TGGTAACAATTGATTTAGATAGG + Intergenic
1073609833 10:104932155-104932177 TTGTAAAAAGTTATTTTTCTTGG + Intronic
1074219080 10:111418670-111418692 TTATAGATACTGATTTAGCTTGG - Intergenic
1074759067 10:116652067-116652089 TTCTTAACACTGCTTTAGCTAGG + Intergenic
1075868643 10:125750724-125750746 TTTTAGAAACTGTTTTAGATAGG - Intronic
1075992690 10:126851057-126851079 TTGTAAAAATAGACTTAACTTGG - Intergenic
1078049996 11:7955794-7955816 TTTTAAAAAATAATTTTGCTGGG - Intergenic
1078962645 11:16296330-16296352 TCTTAAAAACTGAATTATCTAGG - Intronic
1079127226 11:17725817-17725839 TTGTTAAAAGTGATTTACTTTGG - Intergenic
1079739761 11:24043258-24043280 TTGTAAAAAATCAATTACCTGGG - Intergenic
1080442425 11:32307058-32307080 TTTTAAAAAATGAGTTGGCTGGG - Intergenic
1080942308 11:36933074-36933096 TTTTAACAACTTATTTAGATCGG + Intergenic
1081202819 11:40238506-40238528 TTTTAAAAAATGATTCTGCTAGG - Intronic
1084037295 11:66519997-66520019 TTATAAAAACAGGATTAGCTGGG + Intronic
1086775474 11:90826041-90826063 TTGCAAAATCTGATATATCTGGG + Intergenic
1087507958 11:99052076-99052098 TTGTAAATAGTGGTTTAGCATGG + Intronic
1087727791 11:101741904-101741926 TTTTAAATACTGTGTTAGCTGGG - Intronic
1088033528 11:105282054-105282076 ATGTAATGACTGGTTTAGCTTGG + Intergenic
1091560597 12:1609898-1609920 TTTTAAAAGTTGTTTTAGCTGGG - Intronic
1092085134 12:5750818-5750840 TCTTTAAAACTGATTTACCTGGG + Exonic
1092130984 12:6113182-6113204 CTGTAAAAACTGTTCTAGGTGGG - Intronic
1092367181 12:7886320-7886342 TTTTAAAAATTTAATTAGCTGGG - Intronic
1093621295 12:21292888-21292910 TTTTAAAAAGTGTATTAGCTGGG - Intronic
1095479195 12:42617220-42617242 TGGTTAAAACTGATTGAGATTGG - Intergenic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1096625300 12:52891742-52891764 TTTTAAGAACAGTTTTAGCTAGG - Intergenic
1097459713 12:59846150-59846172 TTGTAAAAAGCCATTAAGCTAGG - Intergenic
1097746441 12:63309064-63309086 TTCTAAAAAATGATTTATCTAGG - Intergenic
1098227383 12:68338739-68338761 TTGCATAAACTGAGTTAGATGGG + Intergenic
1099269564 12:80490601-80490623 TTGTCACAACTGAGGTAGCTGGG + Intronic
1099302631 12:80917008-80917030 TTATAAAAACAAATTAAGCTGGG + Intronic
1100109473 12:91221306-91221328 TTTTAAAAATTGTTTTATCTTGG - Intergenic
1102094922 12:110230726-110230748 TTATAAAAACAGATTTTGCATGG + Intergenic
1102229848 12:111255131-111255153 TTCTAAAGACTGATTAAGGTTGG - Intronic
1102959587 12:117084216-117084238 ATGTAAAAACTGTTTAACCTTGG + Intronic
1103472558 12:121193448-121193470 TTTTAAAAATTCATTTAGCCAGG - Intergenic
1104104583 12:125646874-125646896 TTCTAACATCTGATTTATCTGGG - Intronic
1105430735 13:20334804-20334826 AAGTAAAAACTGGTTTAGATCGG + Intergenic
1106425777 13:29627755-29627777 TTCTTAACACTGCTTTAGCTGGG - Intergenic
1106870693 13:34016061-34016083 TTGTTAAAACTGATTGAGACAGG - Intergenic
1107315073 13:39122181-39122203 TTGTAAAAACTGTTTTTCCTGGG - Intergenic
1107370360 13:39739244-39739266 TTGTAAAAACTGATTTAGCTTGG - Intronic
1108556831 13:51601700-51601722 ATGTAGAAACTGATGCAGCTAGG + Intronic
1108801685 13:54104511-54104533 TTGTAGAAACTGCAGTAGCTGGG + Intergenic
1109430490 13:62227183-62227205 TTATAAAAACTGGATTAGCTTGG - Intergenic
1109670595 13:65601478-65601500 TTTTAAAAAATTATTTAGTTGGG - Intergenic
1110654882 13:77986293-77986315 TTGTAAAAGCTTATTTACTTTGG - Intergenic
1110961346 13:81630223-81630245 CTCTAAACACTGCTTTAGCTGGG + Intergenic
1111898539 13:94171624-94171646 TTGTAAAAAGGGATTTTGCTAGG + Intronic
1112465422 13:99640267-99640289 TTTTAAAAAATCATTTATCTTGG + Intronic
1114803212 14:25802889-25802911 ATGTAAAAACAAGTTTAGCTGGG + Intergenic
1115400109 14:32948134-32948156 TTGTTAAAACTAATTTTGTTAGG - Intronic
1116684501 14:48020173-48020195 TTGTACAAACTTACTTAGTTTGG + Intergenic
1116695539 14:48171028-48171050 TTGTAATAATTGATGTAGCCTGG + Intergenic
1117190172 14:53281605-53281627 GTTTAAAAAATGATATAGCTAGG - Intergenic
1117190310 14:53283435-53283457 GTTTAAAAAATGATATAGCTGGG - Intergenic
1118061518 14:62143335-62143357 TTGGAAAAACTGTTTGTGCTTGG - Intergenic
1118816180 14:69315791-69315813 TTTTAAAAACTGATTTGAGTTGG - Intronic
1119213414 14:72849809-72849831 TTTTGAAAACTGAGTTAGCTAGG + Intronic
1119314514 14:73681470-73681492 TTATAAACAATGTTTTAGCTGGG + Intronic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1123427169 15:20182300-20182322 TTCTAACATCTGATTTATCTTGG + Intergenic
1123481107 15:20632064-20632086 CTCTAAACACTGCTTTAGCTGGG - Intergenic
1123536398 15:21188809-21188831 TTCTAACATCTGATTTATCTTGG + Intergenic
1123636904 15:22368301-22368323 CTCTAAACACTGCTTTAGCTGGG + Intergenic
1124009714 15:25828834-25828856 TTGTAAAAACTGACTATCCTCGG + Intronic
1124026805 15:25974288-25974310 TTGTATAAACTCACTTTGCTGGG + Intergenic
1124045117 15:26141674-26141696 ATGTAAAAACAGAATTAGTTTGG + Intergenic
1125178167 15:36849701-36849723 TTGTAAAAGTTGTTTTCGCTAGG - Intergenic
1125613751 15:40991542-40991564 TTAGAACAACTGATTTAACTAGG + Intronic
1126131971 15:45350416-45350438 TGGTAAAATCTGTTTTAGCGAGG - Intergenic
1127852998 15:62930874-62930896 TGGTAAAAACTGAATAAGTTGGG - Intergenic
1128413229 15:67419712-67419734 TTGTAAACAATAAATTAGCTGGG - Intronic
1128654377 15:69449744-69449766 TTTTAAAAATTTAATTAGCTGGG - Intergenic
1130836797 15:87658623-87658645 TTGTTAAAGCTGATTGAGATTGG - Intergenic
1130838926 15:87679275-87679297 TTTTGTAAACTGATTTTGCTTGG - Intergenic
1131954693 15:97720753-97720775 TTGTAAATACTGATTTACTTTGG + Intergenic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1138823851 16:60294522-60294544 TTGTAAAAACACATGTTGCTGGG + Intergenic
1138877448 16:60969882-60969904 TGGTAAAGAATGATTTATCTTGG + Intergenic
1139907537 16:70377050-70377072 TTTTAAAAAATTTTTTAGCTAGG + Exonic
1140160852 16:72492086-72492108 TTTTAAAATCTCTTTTAGCTGGG - Intergenic
1140572269 16:76121410-76121432 TTGGAAAAAGTGATTTATATTGG + Intergenic
1142033377 16:87849486-87849508 TTGTAAAAACAAATTTCGGTAGG - Intronic
1203118702 16_KI270728v1_random:1516027-1516049 TTCTAACATCTGATTTATCTTGG - Intergenic
1142528645 17:563591-563613 TTGTAAAAAGTAAATGAGCTGGG - Intronic
1143624541 17:8102159-8102181 TGGTTAAATCTGCTTTAGCTAGG - Intronic
1143898255 17:10153915-10153937 TTTTAAAATGTAATTTAGCTGGG + Intronic
1144111340 17:12037032-12037054 TTTTAAAAAATGATTTAACTTGG + Intronic
1144143642 17:12375877-12375899 TTGTAAATACTCATTTTCCTTGG - Intergenic
1145362420 17:22222891-22222913 TTTAAAAAAATGAATTAGCTGGG + Intergenic
1145412408 17:22680385-22680407 TAGTAAAACCTTATTTTGCTGGG - Intergenic
1146230484 17:31103672-31103694 TTTTAAAAAATGTTTTGGCTGGG + Intronic
1146366503 17:32233057-32233079 TTGTTAACACAGATTTTGCTGGG - Intronic
1148499116 17:48075628-48075650 TTGTAAACATTGATTTTGCTTGG - Intronic
1149331974 17:55592728-55592750 TTCAAAAAATTGATCTAGCTAGG + Intergenic
1149827221 17:59840002-59840024 TTGTAAAAATTGATACAGGTTGG - Exonic
1150413995 17:64972176-64972198 TTAAAAAAACTAAATTAGCTGGG - Intergenic
1150797640 17:68251504-68251526 TTTAAAAAACTAAATTAGCTGGG + Intronic
1151058907 17:71067979-71068001 TTTTAAAAAATGAATTAGGTTGG + Intergenic
1151462199 17:74261068-74261090 TTGTAAAAACTGGATGTGCTAGG - Exonic
1153742918 18:8147827-8147849 TGCTAAAAACTGAATAAGCTAGG - Intronic
1153969344 18:10211187-10211209 TCGTAAAAACTGGTTTAGAAAGG + Intergenic
1155377029 18:25170513-25170535 TAGTCAAAACTGATTTAGAGAGG - Intronic
1155546491 18:26921290-26921312 TTCTAAAGACTAGTTTAGCTGGG + Intronic
1155998994 18:32363579-32363601 TACTAAAACCTGATTTAGTTAGG - Intronic
1156168032 18:34447679-34447701 TAGTAAGAAGTGATTTAGCATGG - Intergenic
1156751899 18:40469035-40469057 TTGTACAAACTGTGTGAGCTTGG - Intergenic
1156760829 18:40587542-40587564 TTTTAAAAATTGATTCTGCTTGG - Intergenic
1158365270 18:56727315-56727337 TTTTAAAAACAGGTTTAGTTGGG + Intronic
1159194273 18:65091507-65091529 TTGTATAAACTGATATAGTTTGG - Intergenic
1160317556 18:77861549-77861571 TTGTAAAAAGTGATTTGGAGAGG + Intergenic
1162704254 19:12543379-12543401 TTCTAAAAACTGAAATAGCCGGG + Intronic
1162706405 19:12558310-12558332 TTTTAAAAACTGATGGGGCTGGG + Intronic
1163657953 19:18558641-18558663 TTGAAAAAACTGATTCAGAAGGG + Intronic
1164955658 19:32381308-32381330 TTGTCAAAACAGAATTGGCTGGG + Intronic
1165131075 19:33632448-33632470 TAGAAAAAAATGATTTGGCTGGG - Intronic
1165659159 19:37559979-37560001 TTTTAAAAATTTTTTTAGCTGGG + Intronic
1167592604 19:50412574-50412596 GTGTAATTACTGATATAGCTGGG - Intronic
1168566129 19:57425376-57425398 TTGTAAACTCTGATTTCTCTGGG + Intronic
924994825 2:349738-349760 CAGTAAAAACTGATTTGTCTGGG - Intergenic
925536212 2:4919927-4919949 ATTTAAAAATTGATTTAGCTGGG + Intergenic
926618842 2:15028442-15028464 TTGCAAAATCTGATAAAGCTAGG + Intergenic
926635714 2:15176850-15176872 TTGTAAGAAATGATATAGCAAGG - Intronic
928402549 2:30989741-30989763 TTATAAAAACTGAATTAGGTAGG + Intronic
928902619 2:36336701-36336723 TTGTCCAAACTCATTTAGCTAGG - Intergenic
930192062 2:48470220-48470242 TTATAAAAAGTTATTAAGCTGGG + Intronic
930298049 2:49579672-49579694 TTGTAACAATTGATATATCTTGG + Intergenic
931004383 2:57830945-57830967 CTCTAAACACTGCTTTAGCTTGG - Intergenic
933631162 2:84660519-84660541 TTGTAATAATTGATTTAGGCAGG + Intronic
934114363 2:88771547-88771569 ATGTAAAAGTTGATTAAGCTGGG + Intergenic
934864953 2:97799972-97799994 TTTTAAAAAATCATTTAGCAAGG - Intronic
934978205 2:98821072-98821094 ACGTAAAAACTGATTTTGATAGG - Intronic
935647363 2:105350720-105350742 TTTTAAAAACTTATATAGCAAGG - Intergenic
935779345 2:106497907-106497929 TTGTTTAAACTGATGTTGCTGGG - Intergenic
937620909 2:123984163-123984185 TTTTAAAAACTGATTGACATTGG + Intergenic
937850199 2:126625415-126625437 TTGAATAAACTAATTTAGCAAGG + Intergenic
938751776 2:134338463-134338485 TTTTAAAATTTGATTTTGCTTGG + Intronic
939664472 2:144934021-144934043 TTGGAAACACTGACTTAGCATGG - Intergenic
941048247 2:160701055-160701077 TTGAAAAAAATGATTTAATTTGG + Intergenic
941142990 2:161807870-161807892 TCGTGAAAAATAATTTAGCTAGG + Intronic
941936904 2:170989039-170989061 TAGTAACAACTGATTGAGGTAGG - Intergenic
943223398 2:185139033-185139055 ATGCAAAAACAGAATTAGCTGGG - Intergenic
943343623 2:186710828-186710850 TTTTAACAACTGTTTTATCTTGG - Intronic
944514348 2:200496786-200496808 TTTTAAAAACTGCATTGGCTGGG - Intronic
944930963 2:204518701-204518723 TTGTAAAAACTGACTTCCATTGG + Intergenic
945534224 2:210992085-210992107 TTGTAAAAACATATTAGGCTTGG - Intergenic
946829809 2:223717123-223717145 CTGTAAAAATTGCTTCAGCTAGG + Intergenic
1169973617 20:11298814-11298836 TTTTAAAAACTCAATTAACTAGG + Intergenic
1170338706 20:15299533-15299555 TGGGAAAAACTGATTTAGAGAGG - Intronic
1173812495 20:45964655-45964677 TTGTGAAAACTCATTGACCTGGG + Intronic
1174902330 20:54513344-54513366 TTGGAAAAACTGGTGAAGCTGGG - Intronic
1175473528 20:59251822-59251844 TTGTGAAAACTGCTTTCCCTGGG - Intronic
1175562830 20:59945938-59945960 TTGTAAAGAGTGATTTCCCTGGG - Exonic
1177695160 21:24561861-24561883 TTGTAGAAAAGAATTTAGCTAGG - Intergenic
1177798518 21:25804518-25804540 TTTTAAAAACTGACTTTGCCGGG - Intergenic
1178173301 21:30067428-30067450 TTGTAATAAATGAATTAGCTGGG - Intergenic
1178179152 21:30139953-30139975 TTGAAAAAAATCATTTGGCTGGG - Intergenic
1178198627 21:30377689-30377711 TTGTCAAAACTCATTGAACTGGG - Intronic
1179976323 21:44869592-44869614 TTTTAAAAATTGATTCAGCTGGG - Intronic
1180728395 22:17962907-17962929 TTTTAAAAAAAAATTTAGCTGGG - Intronic
1182239661 22:28905340-28905362 TTGCAGATACTGTTTTAGCTGGG + Intronic
1182537127 22:31012806-31012828 TTTTAAGAATTGCTTTAGCTGGG - Intergenic
1182594300 22:31406476-31406498 TTGTATAAACTTTTTGAGCTTGG + Intronic
1184154981 22:42661634-42661656 TTTTAAAAATTGAATTAACTTGG + Intergenic
1184312177 22:43653455-43653477 TTTTAAAAAATATTTTAGCTGGG - Intronic
1185191929 22:49443598-49443620 TTTTAAAAACTGATTTTGGCCGG - Intronic
949118768 3:360313-360335 TTGGTAAAACTGATTTCCCTGGG - Exonic
949284456 3:2384594-2384616 TTTTAAGTCCTGATTTAGCTGGG - Intronic
949575230 3:5332338-5332360 TTTTAAAATCTGATTTTGCATGG + Intergenic
950244278 3:11401171-11401193 TTGTTAAAACAGAAGTAGCTGGG - Intronic
951033232 3:17905711-17905733 TTGTAAAAACACAGATAGCTGGG + Intronic
952314104 3:32217768-32217790 TTCTAAAAACATATTTAGCTGGG - Intergenic
952798719 3:37268016-37268038 TTTTAAAAACTGATTTGGGAGGG + Intronic
953543503 3:43843205-43843227 TTGTCAAACCTGAGTTAGGTTGG - Intergenic
954657031 3:52200435-52200457 TTTTAAAAACAAATTTATCTTGG + Intronic
955519731 3:59763438-59763460 TTGAAGAAGCTGATCTAGCTGGG + Intronic
956981876 3:74648475-74648497 TTTAAAAAACTCATTCAGCTAGG + Intergenic
957153884 3:76521495-76521517 TTTTGAAAACAGATTTATCTGGG + Intronic
958672347 3:97220765-97220787 TTGTACAGACTGATTTGGTTAGG - Intronic
958681894 3:97341834-97341856 TTTGGAAAACTGATTTTGCTGGG - Intronic
959216701 3:103459294-103459316 TTGCACAAACTAATTTATCTAGG - Intergenic
959472052 3:106764077-106764099 TTTTAAAAAATAATTTGGCTGGG - Intergenic
960111298 3:113848090-113848112 GTGGAACAACTGATTTAGCCAGG - Intronic
960866431 3:122204754-122204776 TTATAAAAACCGATTTAACTGGG + Intronic
961320665 3:126071929-126071951 CTTTAAAAAATAATTTAGCTGGG - Intronic
963929524 3:150989094-150989116 TTTTAAAAATTGTTTTAGGTAGG + Intergenic
965188497 3:165498671-165498693 TTGTAAAAGCTGGTTTAGGGAGG - Intergenic
965985659 3:174750085-174750107 TAGTAATTACTGCTTTAGCTTGG - Intronic
967789190 3:193528969-193528991 TTTTAAAAATTGATTTGGCAGGG + Intronic
969949674 4:10822490-10822512 TTGTCAAAACTCAATTAACTGGG - Intergenic
970433865 4:16014236-16014258 TTGTGACATCTGATGTAGCTAGG - Intronic
970840525 4:20463271-20463293 TGTTTAAAACTGATTAAGCTTGG - Intronic
971352581 4:25866291-25866313 TTATAAAAACTATTTTTGCTTGG - Intronic
971829220 4:31668918-31668940 TAGGAAAATCTGATTTGGCTTGG - Intergenic
972115692 4:35630893-35630915 TTGTGAAAACTGATGGAACTTGG + Intergenic
972838771 4:42907013-42907035 TTGTAAAAAGTGATTTATTAAGG + Intronic
973071831 4:45869738-45869760 TTGGAGAAACTTATTTAGCAGGG + Intergenic
973566192 4:52189908-52189930 TGGCCAAAACTGTTTTAGCTTGG + Intergenic
973681653 4:53326967-53326989 TTATAAAGACAGATTTTGCTTGG - Intronic
974623306 4:64388480-64388502 TTGTCAATATTGTTTTAGCTAGG + Intronic
975602905 4:76121624-76121646 TTTTAAAAATAGATTAAGCTGGG - Intronic
975876512 4:78844565-78844587 TTATAAAAACAGTTTTAGATAGG + Intronic
976777343 4:88720933-88720955 TTCTAAAAGCTGATTTTCCTGGG + Intergenic
977445516 4:97126718-97126740 CTGTTAACACTGCTTTAGCTGGG - Intergenic
978510668 4:109514401-109514423 TTATAAAAACTGTATTGGCTGGG + Intronic
978525458 4:109660518-109660540 TTTTAAAAACTGTTTTGGCCTGG + Intronic
980555403 4:134397061-134397083 TTGTAAAAGATAATTTTGCTGGG - Intergenic
981911704 4:149989030-149989052 TTATAAAATTTGCTTTAGCTGGG - Intergenic
982345549 4:154353792-154353814 TTGTAAAAACAGAATTTCCTGGG + Intronic
983971802 4:173884452-173884474 TTGGAAAAGATAATTTAGCTTGG + Intergenic
984909035 4:184654745-184654767 TTTTAAAAACTGCTTCAGCCGGG - Intronic
985254818 4:188059309-188059331 TTTTAAAAAATAAATTAGCTGGG - Intergenic
985886500 5:2684440-2684462 TTGGAAAAACTGATTTAGTTTGG + Intergenic
986185676 5:5434625-5434647 TGGTAAAAACAAATTAAGCTAGG + Intronic
986837870 5:11661657-11661679 TTGTAACAACTGCTTTATTTGGG + Intronic
986940655 5:12945455-12945477 TTTTAAAAAGTGATCTAGTTTGG + Intergenic
989406557 5:41067732-41067754 TTCTAAAAACTATTTTAACTTGG + Intronic
989825604 5:45850752-45850774 CTCTAAACACTGCTTTAGCTGGG - Intergenic
990341634 5:54829062-54829084 TTTTAAAAACCCAATTAGCTGGG - Intergenic
990925540 5:61017601-61017623 TAGTAAAAATTGAAGTAGCTGGG + Intronic
991083611 5:62627287-62627309 TTGCAAAAACTCCTGTAGCTGGG - Exonic
991271283 5:64784921-64784943 TTGTAAAAACTGATGCAGAATGG - Intronic
991370010 5:65908605-65908627 TTTTAAAAACTGATTAGGCCAGG - Intergenic
993568213 5:89502170-89502192 TTGTAAAAACTGAGTTTACATGG - Intergenic
994190357 5:96862283-96862305 TTGTAAAGATTGATTTAGACTGG - Intronic
994572579 5:101533189-101533211 TTGAAAAAACTGATTCAGGCTGG + Intergenic
995534979 5:113126303-113126325 TTTTAAAGACTGTTTTAGCCAGG + Intronic
996365778 5:122699588-122699610 TTGTAAAAGATGTTTTACCTGGG - Intergenic
996946227 5:129072544-129072566 TTGAAAAAACTAATTTAGCCAGG - Intergenic
997102696 5:130986692-130986714 TTGAAAAAATTGATTTAACAAGG - Intergenic
997667129 5:135639739-135639761 TTGTTAGAACTGATCTAGTTTGG - Intergenic
997695100 5:135855274-135855296 TTGTAAAAAATGAAATATCTGGG + Intronic
998461258 5:142311829-142311851 TTGTAAACACGGATTTTTCTGGG - Exonic
1000109788 5:158097383-158097405 TTGTAAACTCTCATTAAGCTAGG - Intergenic
1001072725 5:168600743-168600765 TGGTAGAAACTGAGTTGGCTTGG + Intergenic
1001750842 5:174130008-174130030 TTGTAAAGGCTAATTTAGCATGG - Intronic
1002682405 5:180977099-180977121 TTGAAAAAGCTGAATTAGGTAGG + Intergenic
1004043154 6:12002332-12002354 TTGTAATCAATGATTTAGATGGG + Intergenic
1004087383 6:12463833-12463855 TTCTAAAAACTGAAATAGCCTGG + Intergenic
1004149373 6:13100953-13100975 TTGTTAAAACTGATGTTCCTGGG + Intronic
1004858237 6:19773689-19773711 TTTTAAAAACGGATCTGGCTGGG + Intergenic
1004996658 6:21199765-21199787 TTATAAAAACTGATTTAAATGGG + Intronic
1005145868 6:22689526-22689548 TTTTAAAAAATGCTTTAGCAGGG + Intergenic
1006851396 6:37101458-37101480 TTGCAACAACTGTTTTAGATTGG - Intergenic
1007850187 6:44795173-44795195 TTTTAAAAACTCATTTATCGTGG + Intergenic
1007907775 6:45480252-45480274 TTGTAAAAACAGTTTTATTTTGG + Intronic
1010682175 6:78809691-78809713 GTGTAAAGACTGATGTAGATTGG - Intergenic
1011339943 6:86303210-86303232 TCCTAAACACTGCTTTAGCTGGG + Intergenic
1012008017 6:93741217-93741239 TTGTAATAACTAATTTAATTTGG + Intergenic
1012990923 6:105924981-105925003 TTATAAAAACCATTTTAGCTTGG + Intergenic
1014458833 6:121670288-121670310 TTGAAATAAAGGATTTAGCTGGG + Intergenic
1014708368 6:124776168-124776190 TGATTAAAACTAATTTAGCTTGG + Intronic
1015381215 6:132571399-132571421 TTTTAAAAACTCATTTCGCTTGG - Intergenic
1017144619 6:151223168-151223190 TTGTCAAAAGCCATTTAGCTGGG + Intergenic
1017191379 6:151657167-151657189 CATTAAAAACTGATTTAGATAGG + Intronic
1017273915 6:152543261-152543283 TTGCAAAAACAGATTTTACTAGG + Intronic
1019182312 6:170197687-170197709 TTCTCAAAATTGTTTTAGCTAGG - Intergenic
1020590688 7:10133055-10133077 TTATAAAAATTGATTTGGTTGGG + Intergenic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1022044970 7:26615501-26615523 TTTTAAAAACTGGTATAACTGGG + Intergenic
1022359677 7:29646041-29646063 CTGTAAAAATTGCTTCAGCTAGG - Intergenic
1023197594 7:37658311-37658333 CTTTAAAAACTGTTATAGCTAGG + Intergenic
1024840578 7:53582074-53582096 TTGTTAAAACTCATAGAGCTGGG + Intergenic
1025224606 7:57146093-57146115 TTTTAAAAACTGATATGGCTGGG + Intergenic
1025767674 7:64471763-64471785 TTGGAAAAACAAAATTAGCTGGG + Intergenic
1026130432 7:67616125-67616147 TTGTACACACTGATTTAACCTGG + Intergenic
1028411430 7:90534353-90534375 TAGTAAATTGTGATTTAGCTAGG - Intronic
1028678585 7:93497604-93497626 TTGTTAAAACAGAAATAGCTTGG - Intronic
1028897572 7:96059646-96059668 TTGGAAGAACTGTTTGAGCTGGG + Intronic
1032375081 7:131405835-131405857 TTATAAAAATTGAATAAGCTGGG - Intronic
1032568289 7:132971423-132971445 TTGGAAGAATTGCTTTAGCTGGG - Intronic
1033196288 7:139330246-139330268 TTAAAAAAACTGATTTTGTTTGG - Intergenic
1034495024 7:151415283-151415305 TTTTAAAAACAGCTTTGGCTGGG - Intergenic
1037023813 8:14007342-14007364 TTGGAAAAACTGATTTTCATCGG + Intergenic
1038424575 8:27456213-27456235 TTGTAAAAAATGAAATATCTGGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1043399105 8:79866381-79866403 TTGTAAGAATTGATTTATTTAGG + Intergenic
1044151980 8:88790908-88790930 ATTTAAAAACAGATTTATCTGGG - Intergenic
1044295731 8:90525110-90525132 TGCTAATAACTGATTGAGCTGGG - Intergenic
1045867047 8:106879432-106879454 TTTTAAAAACTGCTATGGCTGGG + Intergenic
1046041961 8:108916394-108916416 GTGTAAAAATTGAGTTTGCTGGG - Intergenic
1046085486 8:109428825-109428847 TTGTATATACTGATTTAACTTGG + Intronic
1046215855 8:111145751-111145773 TTATAAAAACTGTTTTGGCTTGG - Intergenic
1046310362 8:112428268-112428290 TTGTATACTCTGTTTTAGCTTGG - Intronic
1047643892 8:126849886-126849908 TTGCAAAAACTGAAATGGCTTGG + Intergenic
1052008178 9:23375468-23375490 TGGTAAAAACTGATTTTCTTAGG - Intergenic
1052759541 9:32575880-32575902 TTGTAAAAACTGATCTTTTTTGG + Intergenic
1053033837 9:34808030-34808052 TTGCAAAAACATATTTATCTGGG + Intergenic
1059813078 9:117878233-117878255 TTGAAAAAACTGAATCAGATAGG - Intergenic
1186565875 X:10662007-10662029 TTTTAAAAACTCTTTTGGCTCGG + Intronic
1188767526 X:34114202-34114224 CTGTAAAAATTGCTTCAGCTAGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189275931 X:39786117-39786139 TTTTAAAAAATGATTTAGGTGGG - Intergenic
1189490423 X:41467097-41467119 TTAAAAAAATTGTTTTAGCTGGG - Intronic
1191060188 X:56286958-56286980 TTGAAAAAAATGAGTAAGCTCGG - Intronic
1192673897 X:73174927-73174949 TTTTAAAAATTTATTTAGGTTGG + Intergenic
1192872383 X:75196324-75196346 TATTAAAAACTCATTTACCTGGG - Intergenic
1194489977 X:94533854-94533876 TTTTAAAAACTCAATGAGCTTGG + Intergenic
1196432262 X:115639118-115639140 TAGTAAATACAGATTTTGCTGGG + Intronic
1198238234 X:134757096-134757118 TGTTAAAAACTGATTCAGATAGG + Intronic
1198250245 X:134872735-134872757 TTGGGATAACTTATTTAGCTTGG - Intergenic
1201966325 Y:19740585-19740607 GTGTGGAAACTGATTTAGCAGGG - Intronic