ID: 1107370988

View in Genome Browser
Species Human (GRCh38)
Location 13:39747443-39747465
Sequence ATGTATTACATGAATGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107370988_1107370990 0 Left 1107370988 13:39747443-39747465 CCTCCTTCATTCATGTAATACAT 0: 1
1: 0
2: 1
3: 28
4: 309
Right 1107370990 13:39747466-39747488 GAAGATTTCTTTTTATCCAGCGG 0: 1
1: 0
2: 0
3: 28
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107370988 Original CRISPR ATGTATTACATGAATGAAGG AGG (reversed) Intronic
900804847 1:4760842-4760864 ATGTATGGCATGACTGTAGGGGG - Intronic
900877543 1:5355360-5355382 AGGTAATAAATGAATGAATGTGG - Intergenic
902458391 1:16553032-16553054 ATTTATTACATGGAGGAAGGGGG + Intergenic
902493770 1:16854884-16854906 ATTTATTACATGGAGGAAGGGGG - Intronic
903151574 1:21413791-21413813 ATTTATTACATGGAGGAAGGGGG + Intergenic
904817097 1:33212147-33212169 ATGTCTTACATGGTTGAAGCAGG - Intergenic
905930369 1:41782824-41782846 ATATAATGAATGAATGAAGGAGG + Intronic
907257733 1:53192480-53192502 ATGTCTTACATGGCTGGAGGAGG + Intergenic
907697110 1:56742515-56742537 ATGTATTAAATACAGGAAGGAGG - Intronic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
908797856 1:67849182-67849204 ATGTGTTAAAAGAATGTAGGGGG + Intergenic
911559255 1:99383922-99383944 ATGTATTACTTGAATAAGGAGGG - Intergenic
912185147 1:107266403-107266425 ATGTCTTACATGGATGAGGCAGG + Intronic
912407583 1:109453327-109453349 ATGTATCAAATGAAACAAGGGGG + Intergenic
912982921 1:114394256-114394278 ATGTTGTACATGAATGGGGGTGG + Exonic
913607245 1:120477331-120477353 ATTTATCACATGGAGGAAGGGGG - Intergenic
914209190 1:145562809-145562831 ATTTATCACATGGAGGAAGGGGG + Intergenic
914227636 1:145734538-145734560 ATTTGTTAGATGAATGAAAGAGG - Intronic
914268108 1:146055175-146055197 ATTTATCACATGGAGGAAGGGGG + Intergenic
914583948 1:149044507-149044529 ATTTATCACATGGAGGAAGGGGG + Intronic
914936507 1:151985927-151985949 ATTTAATAAATGAATGAATGAGG + Intronic
915050179 1:153061188-153061210 ATATATTATTTGAATGAAGTGGG + Intergenic
917059733 1:171024048-171024070 ATGTATGACATGGATGAACTTGG - Intronic
917894721 1:179476588-179476610 ATGTGTTCCAAAAATGAAGGTGG - Intronic
918975511 1:191480065-191480087 ATGTTTTACATGATAGCAGGGGG + Intergenic
919577656 1:199331955-199331977 GTGTATTGAATGGATGAAGGAGG - Intergenic
923170395 1:231411264-231411286 ATGTCTTACGTGACAGAAGGAGG - Intronic
923291484 1:232550452-232550474 ATTTCTTATATAAATGAAGGTGG - Intronic
924446236 1:244134473-244134495 ATGCATTGCCTGAATGAGGGGGG + Intergenic
1064016522 10:11776862-11776884 AAGTATTACAAGAATCAAGAAGG - Intergenic
1064824289 10:19378209-19378231 ATGTATTCAATTAATGAAGAAGG + Intronic
1066035836 10:31482743-31482765 ATGTATTACCTGAAAAAAGTTGG + Intronic
1067383803 10:45800011-45800033 ATGTAATATATGAATAAAAGAGG + Intergenic
1067930507 10:50556206-50556228 ATTTGTTAAATGAATGAATGAGG - Intronic
1068370509 10:56107509-56107531 ATTTTTTAGATGAATGATGGTGG - Intergenic
1068911702 10:62385175-62385197 ATGTATTACATCAACTAGGGTGG - Intronic
1069038920 10:63673984-63674006 ATGGATTAGATGGATGAATGAGG - Intergenic
1069048665 10:63769168-63769190 ATGAAATACAAGAATAAAGGGGG + Intergenic
1069189162 10:65466079-65466101 ATGTCTTACATGGATGGTGGTGG - Intergenic
1069606348 10:69741082-69741104 ATGTTTCAAATGAATGATGGAGG + Intergenic
1069629879 10:69891025-69891047 ATGCATTAAAAGAAGGAAGGTGG - Intronic
1069947235 10:71996166-71996188 TTGTCTTTCATGAATGAGGGAGG - Intronic
1070785000 10:79157716-79157738 AGGTATTTCAGGAATGCAGGAGG + Intronic
1072775463 10:98187533-98187555 ATGGTTTACAAGAATGAAGTAGG + Intronic
1073503094 10:103959972-103959994 ATGTAATACATAAAAGTAGGGGG + Intergenic
1073662212 10:105489020-105489042 ATGTTCTACATGAATGTAGCAGG - Intergenic
1073740721 10:106403246-106403268 GTATATTACATAAATGCAGGTGG + Intergenic
1073757192 10:106593200-106593222 AAGTTTTCCATGAGTGAAGGGGG + Intronic
1074512743 10:114132614-114132636 AGATATTACATGAATGAGTGTGG + Intronic
1074568173 10:114600510-114600532 ACGAAATACATGAATAAAGGAGG - Intronic
1075229418 10:120661216-120661238 TTGGAGTACAAGAATGAAGGTGG + Intergenic
1076218098 10:128711727-128711749 GAGTATTTCATGAATGAATGAGG - Intergenic
1078874273 11:15378120-15378142 ATGGATGACATGATTGATGGTGG + Intergenic
1079855030 11:25592045-25592067 ATGTCTTACATGGATGGAGGTGG - Intergenic
1080448800 11:32361844-32361866 ATGTATCACTTGAATGAATGAGG - Intergenic
1082184976 11:49168024-49168046 AAGGACTAAATGAATGAAGGGGG - Intronic
1082788913 11:57333770-57333792 AGGTATTACTTTAATGAAAGTGG + Intronic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083944185 11:65915034-65915056 AGTTATTACATGAATGAATGAGG - Intergenic
1084839812 11:71837322-71837344 TTGAATTACATGGATGTAGGGGG - Intronic
1085811224 11:79683068-79683090 ATGTCTTACATGGAAGCAGGAGG - Intergenic
1086433901 11:86763003-86763025 AAGTATTTCATGAAAGAAGAAGG - Intergenic
1086480262 11:87228249-87228271 ATGGAATAAATAAATGAAGGAGG + Intronic
1086681362 11:89677322-89677344 AAGGACTAAATGAATGAAGGGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087808468 11:102582509-102582531 ATGACTTTCATGAATGAAGTGGG + Intronic
1088654385 11:111985466-111985488 GTTTATTAAATGAATGAAGAAGG - Intronic
1089252190 11:117172791-117172813 ATGAACTACATGAATCCAGGAGG - Intronic
1089434400 11:118451996-118452018 ATGTAATACATGAATCAGGAGGG + Intronic
1089608622 11:119656821-119656843 ATGTGCTTCATGAAGGAAGGTGG - Intronic
1091040522 11:132276140-132276162 CTGCATTACATGAATGAACCTGG - Intronic
1093292668 12:17347358-17347380 ACGGATTACATGGATGAAGGAGG - Intergenic
1095127000 12:38491314-38491336 ATTTATTAAAAGAATGAAGCTGG - Intergenic
1096065852 12:48739632-48739654 ATGTCCTACGTGAATGAAGTAGG + Intergenic
1096930213 12:55199629-55199651 ATGTCTTACATGGCTGAAGAGGG - Intergenic
1097842641 12:64336920-64336942 TTATATTACATGAAATAAGGTGG - Intronic
1098486647 12:71029196-71029218 ATGAATTAAATGAATGATTGTGG + Intergenic
1098631050 12:72721685-72721707 ATGTCTTACATGAATGGCAGTGG - Intergenic
1098903071 12:76132703-76132725 ATGTATTACATGACAGGAGCAGG + Intergenic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1100418438 12:94403842-94403864 AACTATTTCATGAATGAAGGAGG + Intronic
1100603973 12:96135817-96135839 ATGTATTGAATGAATGAATAGGG - Intergenic
1100706041 12:97201517-97201539 TTGTATTTGATGAGTGAAGGTGG + Intergenic
1100773219 12:97946927-97946949 ATGTATTGAATGAATGAATGAGG - Intergenic
1101062093 12:100983051-100983073 CTGTCTTGCATGATTGAAGGGGG + Intronic
1101431218 12:104628946-104628968 ATGTACTACATGAAACAAGGGGG + Intronic
1101532979 12:105591363-105591385 CTGTCTTACATGAAAGAAGCTGG - Intergenic
1101759128 12:107644826-107644848 ATGCAGTACATGGATGAAGCTGG + Intronic
1102034397 12:109762559-109762581 AGGTCTTACATGAAGGAAGTGGG - Intronic
1103721344 12:122977132-122977154 AGGTATTGAATGAATGAATGCGG - Intronic
1105744305 13:23362556-23362578 ATGTATTATATAAAAGCAGGTGG - Intronic
1105821918 13:24087617-24087639 AGGCATTACAGGAATGAAGATGG + Intronic
1106733479 13:32566409-32566431 ATGTCTTACATGGCTGAAGAAGG + Intergenic
1106930956 13:34664219-34664241 ATTTTTTACATGAATGAATATGG + Intergenic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1108433406 13:50377440-50377462 ATGTATTACAAGAATGCATTGGG - Intronic
1109104805 13:58237581-58237603 ATGTACTGCATAAATGATGGTGG - Intergenic
1110037480 13:70706836-70706858 ATGGGTTACATGAATAAATGGGG + Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1110800756 13:79691907-79691929 ATGTCTTACATGACTGGAGTAGG + Intergenic
1110817901 13:79881815-79881837 ATGTTTTACATGGCTGAAGCAGG - Intergenic
1110829786 13:80017889-80017911 ATGTGCTAAATGAATGAATGAGG - Intergenic
1111187851 13:84763841-84763863 ATGTAAAGAATGAATGAAGGAGG + Intergenic
1111289321 13:86143737-86143759 ATATATCTCATGAATAAAGGGGG + Intergenic
1111876707 13:93906069-93906091 ATGTATTATAAGGATGCAGGGGG + Intronic
1114148279 14:20004735-20004757 ATGTGTTAAATAAATGCAGGAGG + Intergenic
1115857075 14:37641990-37642012 ATGTATTACATACATGCAGATGG + Intronic
1115966576 14:38896579-38896601 ATGTATTTCATAAATGAAAGGGG + Intergenic
1116829144 14:49700670-49700692 ATGTTTGAAAAGAATGAAGGTGG + Intronic
1117137581 14:52752647-52752669 ATGCATTACATGAATAAAGCAGG + Intronic
1117352922 14:54899088-54899110 ATGGACCACATGTATGAAGGTGG - Intronic
1117564362 14:56978156-56978178 CTGTATTACATGAATGAGTCTGG - Intergenic
1118173617 14:63414184-63414206 ATGTATTAATTTAATTAAGGAGG + Intronic
1118567310 14:67156013-67156035 ATGTACTTCAAAAATGAAGGTGG + Intronic
1118895765 14:69944048-69944070 ATGTATGGCTTGAATGAATGAGG - Intronic
1119025566 14:71149552-71149574 ACGTCTTACATGGATGAAGCAGG - Intergenic
1120606696 14:86587478-86587500 ATGTAACAAAAGAATGAAGGTGG + Intergenic
1120856765 14:89219266-89219288 ATGTCTTACATGGAAGCAGGAGG - Intronic
1121169188 14:91838587-91838609 ATGTGCTGAATGAATGAAGGAGG + Intronic
1121342401 14:93113493-93113515 AAGTCTTACATGACTGCAGGGGG + Intronic
1126327474 15:47496462-47496484 ATGTATTAAATGTAGGGAGGAGG - Intronic
1126490516 15:49231237-49231259 ATGTCTTACATGAGTGGAGCAGG + Intronic
1126579237 15:50227812-50227834 ATTTTTTGCATGAATGAATGAGG + Intronic
1127009478 15:54606842-54606864 AGGAATTACATGGATGAATGTGG + Intronic
1127603372 15:60561603-60561625 ATCTATTACATTATGGAAGGGGG - Intronic
1127951967 15:63816801-63816823 ATCTAACACATGAATGAAGAAGG + Intronic
1129230798 15:74196214-74196236 CTGTATTCCATAAATCAAGGAGG + Intronic
1130042779 15:80418872-80418894 ATTTATTGAATGAATGAATGAGG - Intronic
1131984842 15:98032756-98032778 ATGTATGACAGCAAAGAAGGTGG - Intergenic
1133479046 16:6151611-6151633 ATCTATTAAATGCATGAAGATGG - Intronic
1133642742 16:7733550-7733572 TGTTTTTACATGAATGAAGGTGG - Intergenic
1134442220 16:14305437-14305459 GTGTTTTACATGAATTAACGAGG + Intergenic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1137608931 16:49806036-49806058 ATGAAATACATGTATGAACGAGG - Intronic
1138330825 16:56214059-56214081 ATCCCTTCCATGAATGAAGGGGG + Intronic
1138934796 16:61706028-61706050 ATGTATTGAATGAATGAATAAGG + Intronic
1140468651 16:75202246-75202268 ATGCATTAATTGAATGAAAGGGG + Intergenic
1140493680 16:75363808-75363830 ATTTATTGAATGAATGAATGAGG - Intronic
1140726429 16:77817283-77817305 CTGCATGACATGAATGAAGGGGG - Intronic
1143916114 17:10294685-10294707 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1144254606 17:13454537-13454559 AGGTATAACATGGATGAAGCTGG + Intergenic
1146968475 17:37053143-37053165 ATTTATTGCCAGAATGAAGGAGG - Intronic
1150201551 17:63362473-63362495 ATGGATGACATGATTGATGGTGG - Intronic
1150244862 17:63666820-63666842 ATGTATTAAAAGCATGAAGGTGG + Intronic
1151489682 17:74425347-74425369 AGGGAATAAATGAATGAAGGAGG - Intronic
1153445456 18:5167456-5167478 CTCTTCTACATGAATGAAGGAGG + Intronic
1154053119 18:10982416-10982438 ATCTGTTACATGCATGAATGAGG + Intronic
1154949248 18:21192137-21192159 ATGCTTGACATGAATGACGGTGG + Intergenic
1155745700 18:29354826-29354848 ATGTCTTACATGACAGTAGGAGG - Intergenic
1157087393 18:44595494-44595516 ATGTACTACATTTATGAAGCTGG + Intergenic
1157745941 18:50135654-50135676 GTGTATTACTTAAATGAAGTGGG + Intronic
1158162806 18:54505231-54505253 ATGGACCACATGTATGAAGGTGG + Intergenic
1162197765 19:8998853-8998875 ATGTGTTGCATGAATGAAGGGGG - Intergenic
1164142123 19:22480308-22480330 ATGTATTCCAACAATCAAGGTGG + Intronic
1202709131 1_KI270714v1_random:7071-7093 ATTTATCACATGGAGGAAGGGGG - Intergenic
925697135 2:6592545-6592567 ATGTATGACCTGAGTGAGGGAGG + Intergenic
926270598 2:11363234-11363256 ATTTATTGAATGAATGAATGAGG - Intergenic
927762078 2:25766901-25766923 ATGTATTACAGAAGAGAAGGGGG - Intronic
930834990 2:55783556-55783578 AGGGATTACAGGAATGAAGTGGG + Intergenic
930940802 2:57012507-57012529 ATGTCTTACATGACTGGAGCAGG - Intergenic
930941048 2:57014533-57014555 ATGTCTTACAAGACTGAAGCAGG - Intergenic
932902941 2:75720639-75720661 ATGTATTGCAAGAATGCAAGTGG - Intergenic
933673754 2:85034469-85034491 ATGTTTCAAATAAATGAAGGAGG + Intronic
934113214 2:88761445-88761467 ATGTATTACAGAAGTGAGGGAGG + Intergenic
934868357 2:97835441-97835463 CTGTCTTACATGAATGCAGTTGG - Intronic
937852119 2:126644950-126644972 CTGTCTTACATGACTGAAGAAGG - Intergenic
938593356 2:132761833-132761855 ATATATTACATGAGTGATGATGG - Intronic
939247066 2:139638943-139638965 ATATATTGCATAAATGAAGCTGG + Intergenic
939380406 2:141428173-141428195 ATGTATTAAATAAATTAAGTAGG + Intronic
939620515 2:144413293-144413315 ATTTGTTGAATGAATGAAGGAGG + Intronic
939692237 2:145278126-145278148 ATGAATTACAGGAATGAATTGGG + Intergenic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
941449523 2:165643110-165643132 ATGTGTTAAATGAATGAGTGGGG - Intronic
942081629 2:172404756-172404778 ATGTATTTCATAAAAGAATGTGG - Intergenic
942640772 2:178058632-178058654 ATATGTTACATGAATAAATGAGG - Intronic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
944199720 2:197093073-197093095 ATGTATTTAAAGAATGAGGGAGG - Intronic
945609797 2:211985637-211985659 ATGTATTAGAAGGATGAAAGGGG + Intronic
945699795 2:213154913-213154935 ATTTATTAAATGAATGAATATGG + Intergenic
945725571 2:213469422-213469444 ATGTTTTTAATGAAAGAAGGAGG + Intronic
947456320 2:230257345-230257367 ATGTAGCACATCACTGAAGGAGG + Intronic
947464716 2:230332512-230332534 ATGTATTACGAGAATGGATGGGG - Intronic
948090139 2:235286478-235286500 ATGTGTTCCATGAATAAAAGCGG - Intergenic
948126079 2:235565381-235565403 CTGTTTTATAGGAATGAAGGGGG + Intronic
1169641670 20:7759086-7759108 CTGTATCCCATGAATGAACGTGG - Intergenic
1170340403 20:15320533-15320555 ATGGATAAAATGAATGAATGAGG - Intronic
1171490356 20:25512491-25512513 ATGTCTTACATGACTGGAGAAGG - Intronic
1171490543 20:25513773-25513795 ATGTCTTACATGACTGGAGAAGG - Intronic
1172963014 20:38811994-38812016 ATGCATTAAAGGAATGAATGAGG + Intronic
1174088722 20:48029423-48029445 ATCTATTACATGAAAAAGGGAGG - Intergenic
1177128240 21:17223388-17223410 ATGTATTACATGTGTAATGGTGG + Intergenic
1178111428 21:29373812-29373834 AAGTATTTCATGAATGGAGTTGG + Intronic
1178753854 21:35329005-35329027 ACATATTAGTTGAATGAAGGAGG - Intronic
1179137920 21:38696922-38696944 AAGCCATACATGAATGAAGGTGG - Intergenic
1182919016 22:34062453-34062475 ATGTGTTACATGAAAGAATAAGG + Intergenic
1183000894 22:34857740-34857762 AAGTATTCCATGTATGAAGCTGG - Intergenic
951639750 3:24823647-24823669 AACTCTTACATAAATGAAGGTGG - Intergenic
953221391 3:40974801-40974823 ATCTATTAAATTAATAAAGGAGG - Intergenic
955039565 3:55302528-55302550 ATGTATTAAATGAATCAATTTGG - Intergenic
955287443 3:57656385-57656407 ATGTAATACATGAATGCACATGG - Intronic
955536192 3:59926263-59926285 AAGTGTTACATGAATGAAACAGG - Intronic
955765910 3:62343713-62343735 ATGTCTTACATGTCTGAAGAAGG - Intergenic
956410447 3:68973322-68973344 ATGTAATGCAGGAAGGAAGGAGG - Intergenic
956475093 3:69610987-69611009 ATGTCTTACATGGATGGTGGTGG - Intergenic
957868707 3:86059778-86059800 AAGTATTACCTGAATGATGCAGG - Intronic
958256443 3:91331087-91331109 ATGTTTTACATGGCTGAAGCAGG - Intergenic
958256699 3:91333011-91333033 CTGTATTACATGACTGGAGCAGG - Intergenic
958529234 3:95304181-95304203 ATTTATTACATGACTCAAGAAGG - Intergenic
958695057 3:97516899-97516921 ATGAAATAAATGAATGAGGGGGG - Intronic
958780323 3:98533058-98533080 ATCTTCTGCATGAATGAAGGTGG - Exonic
959583923 3:108008488-108008510 ATGTAATGCATAAAAGAAGGAGG + Intergenic
960258285 3:115534077-115534099 ATGTGTTGAATGAATGAAGAAGG - Intergenic
963002844 3:140699160-140699182 ATTTATTCCATGAATGGAAGTGG - Intronic
963073757 3:141327737-141327759 ATGTAATACATGAATAATGGAGG + Intronic
963340608 3:144027957-144027979 ATTTGTTGAATGAATGAAGGAGG - Intronic
963570266 3:146985941-146985963 ATATATTTCATGACTGATGGTGG - Intergenic
963658959 3:148099895-148099917 ATGGATCACATGTATGATGGTGG - Intergenic
964411402 3:156401538-156401560 ATGGACTACATGAATGAACTTGG - Intronic
964552086 3:157896459-157896481 TTGTATTACAAAAATGAATGTGG - Intergenic
966786825 3:183630015-183630037 ATGTATTACAGAAATGGAGATGG + Intergenic
970359665 4:15296200-15296222 ATGGATTACATGAACCAAGCAGG - Intergenic
971001918 4:22332847-22332869 CTGTATCACATATATGAAGGTGG + Intergenic
971117630 4:23666390-23666412 TTTTATTTAATGAATGAAGGAGG + Intergenic
971176017 4:24283390-24283412 ATGTATTAAATACCTGAAGGTGG - Intergenic
971246628 4:24935031-24935053 ATGGATTAGAGGAAAGAAGGAGG + Intronic
971365956 4:25977396-25977418 ATCTGTTACATGAATGGAAGAGG + Intergenic
971669626 4:29540632-29540654 ATGTATTGCATGACTGAAAGTGG + Intergenic
972060939 4:34872342-34872364 ATGTAATACATGTAGGAAGTTGG - Intergenic
972812812 4:42609072-42609094 GTGTATTACATGATTGAAAGAGG - Intronic
972850854 4:43048639-43048661 ATTTAATATATGAATCAAGGAGG + Intergenic
973694235 4:53474374-53474396 AGGCAATACATGAATGAATGAGG - Intronic
974133042 4:57779934-57779956 ATTTATTAAATGAATGAACGAGG - Intergenic
974903220 4:68026585-68026607 ACCTGTTACATTAATGAAGGTGG + Intergenic
975901859 4:79162936-79162958 ATGTGTTACATTTATGAAGTAGG + Intergenic
976341070 4:83945414-83945436 ATGTAATACATGATCCAAGGAGG - Intergenic
976455991 4:85247348-85247370 ATGCATCACAAGAATGGAGGGGG - Intergenic
976584701 4:86782275-86782297 AGGTATGACATGAAAGAGGGTGG - Intronic
976779022 4:88738111-88738133 ATGTATTTAATGAAGAAAGGAGG - Intronic
977101454 4:92821597-92821619 TTGTATTACATTAATGAATGTGG - Intronic
977354125 4:95924246-95924268 TTATATAACATAAATGAAGGTGG + Intergenic
977417586 4:96753631-96753653 ATTTATCACATGAATTAATGAGG + Intergenic
977567992 4:98600927-98600949 CTGTAGTCCATGAATCAAGGAGG - Intronic
977741404 4:100487712-100487734 ATGTCTTACATGACGGCAGGTGG - Intronic
977975556 4:103261487-103261509 AGGTTTTACTTGAATGAAGCAGG + Intergenic
978998569 4:115187553-115187575 ATGTATTACATGGTGGCAGGAGG + Intergenic
979613623 4:122717148-122717170 ATTTGTTAAATGAATGAAAGAGG - Intergenic
979957047 4:126967213-126967235 ATGTCTTATATTAATGAAGAAGG + Intergenic
982407943 4:155041534-155041556 ATTTATTAAATGAATGAATGTGG - Intergenic
982819226 4:159925898-159925920 AAGTGTTGCAGGAATGAAGGAGG + Intergenic
982890130 4:160836832-160836854 ATGAATTACATATATGATGGTGG - Intergenic
984712480 4:182897474-182897496 ATTTATCAAATGAATAAAGGAGG - Intronic
984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG + Intronic
986718196 5:10539084-10539106 ATGTGTTACAGGAACGAAGGGGG - Intergenic
987283511 5:16435057-16435079 AGTTATTACATGAAGGAGGGAGG - Intergenic
989007908 5:36835601-36835623 ATCTATTACATGAAAGAAACGGG + Intergenic
990056007 5:51579300-51579322 ATTTATTACATGATTGAACTTGG + Intergenic
990232677 5:53731135-53731157 ATGTCTTACATGACTGGAGCAGG - Intergenic
992581759 5:78185115-78185137 ATATATTTCAGGAATGAAGGGGG + Intronic
993177852 5:84511163-84511185 ATGAATTGCATGTATGACGGTGG - Intergenic
993434098 5:87870218-87870240 AAGAATTGCCTGAATGAAGGTGG + Intergenic
993590232 5:89785744-89785766 AAGTAATACATGAGTCAAGGAGG + Intergenic
993714295 5:91259698-91259720 ATGGATGAAATGAATGAAGCAGG - Intergenic
994557969 5:101329269-101329291 CTGTATTACTTGAATAAAGGAGG - Intergenic
996419796 5:123249974-123249996 ATGGATCACATGTATGACGGTGG + Intergenic
997708525 5:135982403-135982425 ATGTCTTACATGAGTGTAGTTGG + Intergenic
997849598 5:137319379-137319401 ATGTGTTAGATGAAAGAAAGGGG - Intronic
1005460071 6:26060013-26060035 ATTTAATTCATTAATGAAGGAGG - Intergenic
1006817978 6:36866274-36866296 ATGTATTACAAGAAAGCATGTGG + Intronic
1007313645 6:40966785-40966807 ATATATTATATATATGAAGGAGG + Intergenic
1008998639 6:57688149-57688171 CTGTATTACATGACTGGAGCAGG + Intergenic
1008998890 6:57690074-57690096 ATGTTTTACATGGCTGAAGCAGG + Intergenic
1009187125 6:60587528-60587550 CTGTATTACATGACTGGAGCAGG + Intergenic
1010250764 6:73704743-73704765 ATGTGAAACATGAATGAATGGGG + Intronic
1011103060 6:83745637-83745659 CTTTATAACATGAATTAAGGAGG - Intergenic
1011283868 6:85704074-85704096 ATGTGTTACATGGATGGAGCAGG - Intergenic
1012635113 6:101528218-101528240 ATGTTTTACATGAGTGACTGTGG - Intronic
1013282640 6:108653157-108653179 ATGTCCTACATGAGTGAAGATGG - Intronic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1016438195 6:144059145-144059167 ATGGAATGCAGGAATGAAGGAGG - Intronic
1016516416 6:144897383-144897405 ATGTAAAACAGGAATTAAGGAGG + Intergenic
1016884245 6:148944123-148944145 ATTTATTAGAGGAATGAAGGGGG + Intronic
1017581889 6:155874033-155874055 ATGATTTAAATGAATGAAAGAGG + Intergenic
1018424436 6:163667607-163667629 ATATATTAAATGAATGAATAGGG - Intergenic
1019503132 7:1375542-1375564 GTTTATTAAATGAATGAAAGAGG + Intergenic
1020881928 7:13773112-13773134 ATGGATTGCATGTATGATGGTGG + Intergenic
1021135798 7:16963923-16963945 ATATATTCAATGATTGAAGGTGG - Intergenic
1021728322 7:23571464-23571486 ATATACTACTTGGATGAAGGAGG + Intergenic
1022412176 7:30147912-30147934 ATTTATTGAATGAATGAATGTGG - Intronic
1025562358 7:62383198-62383220 ATGTACACCATGAATGAAGCTGG - Intergenic
1026286353 7:68966558-68966580 ATGTATGAGAGGGATGAAGGTGG - Intergenic
1029032686 7:97485496-97485518 ATGTATCACATGATTTGAGGGGG + Intergenic
1029913192 7:104177181-104177203 ATAAATTAGATGAATGTAGGTGG + Intronic
1031027953 7:116701638-116701660 ATATATTAAATGTATGTAGGGGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031998858 7:128251570-128251592 ATATATTACAGGGATGAAGGTGG + Intronic
1034064833 7:148126344-148126366 ATGAATGAAATGAATGAATGAGG + Intronic
1036704755 8:11038839-11038861 ATTTATTACATGCCTGAAGTCGG - Intronic
1039090727 8:33826717-33826739 ATGTGTTACCTCAGTGAAGGTGG - Intergenic
1039662821 8:39485503-39485525 ATGTTTACCATGAATGAATGTGG - Intergenic
1041784802 8:61620028-61620050 ATGTTTTATATGAATGAATGTGG - Intronic
1042420113 8:68578279-68578301 ATGAACTACATGAAGAAAGGAGG - Intronic
1042631837 8:70825946-70825968 ATGTATTACATGATGCAAAGAGG - Intergenic
1043357776 8:79433732-79433754 TTGTGTAACATGAATGAAAGTGG - Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1047259669 8:123244292-123244314 AAGAATTACAGGAAAGAAGGAGG - Intronic
1047441360 8:124881275-124881297 ATGACCTACATGAATGAAGCAGG - Intergenic
1047530479 8:125669725-125669747 ATGTAAGACTTAAATGAAGGTGG - Intergenic
1048656665 8:136545267-136545289 AAGTATCACTTGAATGCAGGAGG + Intergenic
1051757305 9:20416921-20416943 ATGTATTACATGAACAAACATGG - Intronic
1052109226 9:24559969-24559991 ATGTATTAACTGTATGAACGTGG + Intergenic
1052328016 9:27237950-27237972 ATTTGTGACATGAATGAAGTTGG + Intergenic
1052463325 9:28795444-28795466 AATTATTACATGCCTGAAGGGGG + Intergenic
1056080132 9:83084444-83084466 ATGTCTTACATGAATTAACCTGG + Intergenic
1056163847 9:83923183-83923205 ATGAAATATAGGAATGAAGGTGG + Intergenic
1056589828 9:87957942-87957964 ATGTATTATATGTATGTGGGCGG + Intergenic
1056707466 9:88964222-88964244 ATTTTTTACATGAATGAACCTGG + Intergenic
1057242831 9:93427191-93427213 ATGAGTTAAATGAATGGAGGCGG - Intergenic
1057701438 9:97365915-97365937 ATCAATTAGATGAATGAATGAGG - Intronic
1060033215 9:120233331-120233353 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1060159012 9:121343053-121343075 AAGTGTTAAATGAATAAAGGGGG + Intronic
1060250502 9:121983154-121983176 ATGGATTGGATGTATGAAGGAGG + Intronic
1187742349 X:22369667-22369689 ATGTTTTACATGGTTGAAGAAGG - Intergenic
1188447390 X:30270081-30270103 ATGTATTAAATAAATGAAAATGG - Intergenic
1189305862 X:39986232-39986254 GTGTTTTACCTGAAGGAAGGAGG - Intergenic
1189575340 X:42345754-42345776 ATGGATAACAAGAATGAAAGAGG - Intergenic
1189746816 X:44177120-44177142 AAGTGTTCCTTGAATGAAGGAGG + Intronic
1191023852 X:55892434-55892456 ATGTTTTACATGGAGGAAGCAGG + Intergenic
1191626701 X:63277953-63277975 ATGTACTACATGAAAGACGTAGG - Intergenic
1191754430 X:64579118-64579140 ATGTATGACATGAATTAGAGAGG + Intergenic
1192552021 X:72062093-72062115 ATCTATTGAATGAATGAATGAGG + Intergenic
1193484635 X:82071517-82071539 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1194354156 X:92860142-92860164 ATGAAGGACATGAATGAAGCTGG + Intergenic
1194599346 X:95901309-95901331 ATTTGTTAAATGAATGAATGAGG - Intergenic
1194653460 X:96543367-96543389 ATCTATTACAAGAAAGAATGAGG - Intergenic
1197103855 X:122689552-122689574 ATGTCTTACATGGCTGAAGCAGG - Intergenic
1197563654 X:128054225-128054247 AGGTATTACATGTATAATGGTGG + Intergenic
1198329046 X:135604601-135604623 AAGTGTTAGATGAATGAAGCAGG + Intergenic
1198767835 X:140096279-140096301 ATTTATTAAATGAGTGGAGGAGG + Intergenic
1200662509 Y:5977163-5977185 ATGAAGGACATGAATGAAGCTGG + Intergenic