ID: 1107377122

View in Genome Browser
Species Human (GRCh38)
Location 13:39815934-39815956
Sequence ATCAAAAATATCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107377117_1107377122 -5 Left 1107377117 13:39815916-39815938 CCCCCCGGAGTTGTGAAAATCAA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377111_1107377122 25 Left 1107377111 13:39815886-39815908 CCACTTGACGTCAGTAGAAATGC No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377120_1107377122 -8 Left 1107377120 13:39815919-39815941 CCCGGAGTTGTGAAAATCAAAAA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377115_1107377122 -1 Left 1107377115 13:39815912-39815934 CCCACCCCCCGGAGTTGTGAAAA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377116_1107377122 -2 Left 1107377116 13:39815913-39815935 CCACCCCCCGGAGTTGTGAAAAT No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377110_1107377122 26 Left 1107377110 13:39815885-39815907 CCCACTTGACGTCAGTAGAAATG No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377118_1107377122 -6 Left 1107377118 13:39815917-39815939 CCCCCGGAGTTGTGAAAATCAAA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377121_1107377122 -9 Left 1107377121 13:39815920-39815942 CCGGAGTTGTGAAAATCAAAAAT No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377113_1107377122 3 Left 1107377113 13:39815908-39815930 CCCTCCCACCCCCCGGAGTTGTG No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377114_1107377122 2 Left 1107377114 13:39815909-39815931 CCTCCCACCCCCCGGAGTTGTGA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data
1107377119_1107377122 -7 Left 1107377119 13:39815918-39815940 CCCCGGAGTTGTGAAAATCAAAA No data
Right 1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107377122 Original CRISPR ATCAAAAATATCTCCAGACA TGG Intergenic
No off target data available for this crispr