ID: 1107379880

View in Genome Browser
Species Human (GRCh38)
Location 13:39845399-39845421
Sequence GTGTGGATCTGTAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107379873_1107379880 21 Left 1107379873 13:39845355-39845377 CCTATCCAACTTTCCGGTGTTGA No data
Right 1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG No data
1107379874_1107379880 16 Left 1107379874 13:39845360-39845382 CCAACTTTCCGGTGTTGATTGCA No data
Right 1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG No data
1107379875_1107379880 8 Left 1107379875 13:39845368-39845390 CCGGTGTTGATTGCACATAAAAA No data
Right 1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107379880 Original CRISPR GTGTGGATCTGTAGGGAAAA TGG Intergenic
No off target data available for this crispr