ID: 1107380031

View in Genome Browser
Species Human (GRCh38)
Location 13:39847057-39847079
Sequence CGATGTACTCATTGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107380031_1107380038 17 Left 1107380031 13:39847057-39847079 CCAAGCTGACAATGAGTACATCG No data
Right 1107380038 13:39847097-39847119 GAAGCCAGAGCAGGGTCAGAAGG No data
1107380031_1107380035 9 Left 1107380031 13:39847057-39847079 CCAAGCTGACAATGAGTACATCG No data
Right 1107380035 13:39847089-39847111 GATTCCCAGAAGCCAGAGCAGGG No data
1107380031_1107380034 8 Left 1107380031 13:39847057-39847079 CCAAGCTGACAATGAGTACATCG No data
Right 1107380034 13:39847088-39847110 AGATTCCCAGAAGCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107380031 Original CRISPR CGATGTACTCATTGTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr