ID: 1107387819

View in Genome Browser
Species Human (GRCh38)
Location 13:39931553-39931575
Sequence ATGTCTAAGTACATGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107387817_1107387819 -3 Left 1107387817 13:39931533-39931555 CCAGCACTGAGTGTAAGAGAATG No data
Right 1107387819 13:39931553-39931575 ATGTCTAAGTACATGGATATAGG No data
1107387816_1107387819 24 Left 1107387816 13:39931506-39931528 CCATGGTTAATTTTTCAGGACAA No data
Right 1107387819 13:39931553-39931575 ATGTCTAAGTACATGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107387819 Original CRISPR ATGTCTAAGTACATGGATAT AGG Intergenic
No off target data available for this crispr