ID: 1107389706

View in Genome Browser
Species Human (GRCh38)
Location 13:39951427-39951449
Sequence CTGATCCTGTGTAACATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107389706_1107389718 3 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389718 13:39951453-39951475 TGGGGGAGGAGGGAGGGCAGGGG No data
1107389706_1107389728 22 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389728 13:39951472-39951494 GGGGGTGGATGGGGAGGGGAGGG No data
1107389706_1107389713 -7 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389713 13:39951443-39951465 GGATCAGCTGTGGGGGAGGAGGG No data
1107389706_1107389714 -4 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389714 13:39951446-39951468 TCAGCTGTGGGGGAGGAGGGAGG No data
1107389706_1107389721 11 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389721 13:39951461-39951483 GAGGGAGGGCAGGGGGTGGATGG No data
1107389706_1107389717 2 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389717 13:39951452-39951474 GTGGGGGAGGAGGGAGGGCAGGG No data
1107389706_1107389727 21 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389727 13:39951471-39951493 AGGGGGTGGATGGGGAGGGGAGG No data
1107389706_1107389722 12 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389722 13:39951462-39951484 AGGGAGGGCAGGGGGTGGATGGG No data
1107389706_1107389715 -3 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389715 13:39951447-39951469 CAGCTGTGGGGGAGGAGGGAGGG No data
1107389706_1107389723 13 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389723 13:39951463-39951485 GGGAGGGCAGGGGGTGGATGGGG No data
1107389706_1107389729 23 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389729 13:39951473-39951495 GGGGTGGATGGGGAGGGGAGGGG No data
1107389706_1107389724 16 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389724 13:39951466-39951488 AGGGCAGGGGGTGGATGGGGAGG No data
1107389706_1107389719 4 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389719 13:39951454-39951476 GGGGGAGGAGGGAGGGCAGGGGG No data
1107389706_1107389730 24 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389730 13:39951474-39951496 GGGTGGATGGGGAGGGGAGGGGG No data
1107389706_1107389716 1 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389716 13:39951451-39951473 TGTGGGGGAGGAGGGAGGGCAGG No data
1107389706_1107389726 18 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389726 13:39951468-39951490 GGCAGGGGGTGGATGGGGAGGGG No data
1107389706_1107389712 -8 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389712 13:39951442-39951464 AGGATCAGCTGTGGGGGAGGAGG No data
1107389706_1107389720 7 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389720 13:39951457-39951479 GGAGGAGGGAGGGCAGGGGGTGG No data
1107389706_1107389725 17 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389725 13:39951467-39951489 GGGCAGGGGGTGGATGGGGAGGG No data
1107389706_1107389731 28 Left 1107389706 13:39951427-39951449 CCACAGATGTTACACAGGATCAG No data
Right 1107389731 13:39951478-39951500 GGATGGGGAGGGGAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107389706 Original CRISPR CTGATCCTGTGTAACATCTG TGG (reversed) Intergenic
No off target data available for this crispr