ID: 1107399137

View in Genome Browser
Species Human (GRCh38)
Location 13:40051757-40051779
Sequence CTGTGTCAAGGCCATCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107399131_1107399137 9 Left 1107399131 13:40051725-40051747 CCAAGACCAGGAACCATTGAGCT No data
Right 1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG No data
1107399130_1107399137 20 Left 1107399130 13:40051714-40051736 CCTGGACTCAGCCAAGACCAGGA No data
Right 1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG No data
1107399128_1107399137 28 Left 1107399128 13:40051706-40051728 CCATTTAACCTGGACTCAGCCAA No data
Right 1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG No data
1107399133_1107399137 3 Left 1107399133 13:40051731-40051753 CCAGGAACCATTGAGCTTGGCAA No data
Right 1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG No data
1107399134_1107399137 -4 Left 1107399134 13:40051738-40051760 CCATTGAGCTTGGCAAGAGCTGT No data
Right 1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107399137 Original CRISPR CTGTGTCAAGGCCATCCTTA GGG Intergenic
No off target data available for this crispr