ID: 1107403409

View in Genome Browser
Species Human (GRCh38)
Location 13:40091097-40091119
Sequence GCAGACTGTAGTATTCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107403409_1107403410 11 Left 1107403409 13:40091097-40091119 CCTGAGTGAATACTACAGTCTGC No data
Right 1107403410 13:40091131-40091153 TAAACTCAATTCATTAAATGAGG No data
1107403409_1107403411 15 Left 1107403409 13:40091097-40091119 CCTGAGTGAATACTACAGTCTGC No data
Right 1107403411 13:40091135-40091157 CTCAATTCATTAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107403409 Original CRISPR GCAGACTGTAGTATTCACTC AGG (reversed) Intergenic
No off target data available for this crispr