ID: 1107405963

View in Genome Browser
Species Human (GRCh38)
Location 13:40113673-40113695
Sequence AAATCTATGCAGCTTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107405961_1107405963 1 Left 1107405961 13:40113649-40113671 CCAAAAAGGTCCATATAGGAGAT No data
Right 1107405963 13:40113673-40113695 AAATCTATGCAGCTTATCACTGG No data
1107405962_1107405963 -9 Left 1107405962 13:40113659-40113681 CCATATAGGAGATAAAATCTATG No data
Right 1107405963 13:40113673-40113695 AAATCTATGCAGCTTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107405963 Original CRISPR AAATCTATGCAGCTTATCAC TGG Intergenic