ID: 1107408425

View in Genome Browser
Species Human (GRCh38)
Location 13:40137008-40137030
Sequence TAGGGTGAGCTGACGTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107408420_1107408425 13 Left 1107408420 13:40136972-40136994 CCTAAGATATGAAGGTCAACAAT No data
Right 1107408425 13:40137008-40137030 TAGGGTGAGCTGACGTAAGTTGG No data
1107408419_1107408425 16 Left 1107408419 13:40136969-40136991 CCTCCTAAGATATGAAGGTCAAC No data
Right 1107408425 13:40137008-40137030 TAGGGTGAGCTGACGTAAGTTGG No data
1107408418_1107408425 17 Left 1107408418 13:40136968-40136990 CCCTCCTAAGATATGAAGGTCAA No data
Right 1107408425 13:40137008-40137030 TAGGGTGAGCTGACGTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107408425 Original CRISPR TAGGGTGAGCTGACGTAAGT TGG Intergenic
No off target data available for this crispr